Description :
From Genome Similarity Track
Location :
Scaffold_1030:7058- 8350
Sequence
1292 bases(100 bases per row)
TTGAGCCGGCTCACGAACGGTTGTACACCGCCGGCAGCAGCATAGGCTGTAACCTGTGACCCAGGCTGTGACTCACTTGCATGTTAACGTGCAGTATCCA
ATTCGAAGTAAATACATTACTCGTTGGGGACGAGATTTTGCAATCAGAGAGTTGCAACTGTGCGTTCGGTGACAATTATGAGGATATCTGAAACTAGGGC
TAGCCGTAGACTGGAATATAGCCAATATCGAAATTCGTGTAGGCGGGCATAATATGCCCGCCTACACGAATTTTAGGAATGCTGAGTTAAAGTGCTTTAC
CGTTCGCGTATCTCCTGCGGCTGCGAAGCAGCCGCAACATCTACGCAGACTTTCACTATTGACCTACCGACCATTGTATAATTTTGACATATAGTTTTGA
ACTATTTGAGGTTGTGAGCTGTCAAAAGCGAAAGCTAATGCTCATAATCGGAGACCCGCGGTGCCGCCTAAAAGTTGTAACTTTTTGAAACCGGGTTCAA
TAGGTACCTAactacgcacttggcatgcgttcgatgcattccaaaacccaatatcCCACTCAAACAAACCATAATCaaatcaacaaaccttcaCATAGAC
AaaccaagtgagtagcaaccaggaataaccagttaatcaactcaatttccttccttgAGCACGTTCATCTATTGAAGTTTTTGTACAGCAAGGGAGGGTT
TCTCCCGAGGTGATCAGCGAGGAATTTCCCAACGCAGCGAGATCCTGCCACGTCGATGCTGTGGAGTTCCTGTACTCCTGATCTCGCCCAAGCTGGTTGA
TATGGCGTTTAAAAAAGCTGGTGTAGCTTCGAAGCTTCCAACGGTAACGATCTCTACGCCATGGAATCGTTGTTCTACAGTGGATGTTTCTcccagttgc
tgcttcaggaGACATTGCGGATGCGCTCTTCTCTTCCAAATgagtgttgttgttgtgagGCTGAAACAAGAGAGCGACAGGCATGTCGAAAACTATCAAA
TTCAACAATGATGCGCATCATTTTCGATTTCATCTCCTCAAGCATGAGGATCGTTGTACACATCAAATGAGTTTGTCCCTACATTCGTAGTATACGGGAT
AACTGCATTGAGTTTGTTGTAAACTCGTTTGAACGCAGGTGTGGGTGTCTATCGCACGAGTTGACTTCTTTTGAAGCCAGTAAGAAGTAAACGTTGCTCT
CACAATGTTGCTATCTGATACTAGTAGTACAAAGCAGTAGTGTTACTAACTAATTGAAGTGAAGTTAGCAATAGGTGTATTGTTGATAAGAG