Description :
From Genome Similarity Track
Location :
Scaffold_888:7057- 8948
Transcript NameFunction/comments
Phypl_g11474myosin-like protein

Sequence
1891 bases(100 bases per row)
CCCGAGGGCATCGAAGATATGACGGCGCTCAACTACCTGCACGAGGCCGCCATCCTTTACAacgtcaagaagcgcttcctgcggGAGCTGCCCTACACGT
ACACAGGGGACATCTGCATCGCCGTGAACCCTTACCAGTGGTTACCGGAGCTCTACTCGGAGCAGACGCAGTCCCAGTACCTTACCAAGGCTCGGGACGA
GCTTCCGCCTCACGTGTACGCGACGTCCATGGCGTCGTACAACGACATGAAGCGGCATAAAGTGAACCAGTCCATCTTGGTGAGTGGAGAGTCGGGAGCT
GGCAAGACGGAGACCACCAAGATTCTCATGAATCATTTGGCCTCTATTGCGGGCGGGCTTAATGACTATACTATCAAGAAAATCATTGAGGTGAAtccgc
tgctcgagtcgtTCGGTAACGCCAAGACGGTGCGAAACGACAACAGTTCTCGATTCGGCAAGTTCACTCAGCTGCAATTCGACACTGCTGGTATCCTGGT
GGGAGCGAGATGCAGAACGTACTTGCTCGAAAAGACCCGTGTGATTTCTCACGAAGAGATGGAACGCAATTACCACATTTTCTACCAGTTGCTGGCAGCG
AGAGACAGCAAGGAGAAGTGGTGTTTGGATGACGCCAACAAGTGTTATGCGTACACGGGCTCTAACAAGACTATTAAGATTGAAGGTGTGTCGGATGACA
AGCACTTCGAGCGTACCAAAACAGCGCTAGGACTGATTGGTGTCACAGAGGAACAACAGGGGGTCCTATTTGAAGTGCTTGCAGGTGTGTTACATCTTGG
CCAAGTGGAAATCCAGCCAAAGAATAATAACGAAGAGTCTGAAATTGTACCGGACGACCAAGGTGCACAGAATGCGACCAAACTGCTCGGTATTTCATCA
GCCGatctggagaaggcgctgtGTTCGCGCCAaatcgcagtcgctggagatAAGGTGACTACCTTTTTGAAGAAGGATCAAGCGGAGGAGTGTATCGGTG
CTTTATCGAAGGCTATTTACTCCAACGTGTTCGACTGGCTGGTCGAAATGATCAATTCGTCTCTGCAGAATGATAAGAAGATGCGACACCAGGTGGGCAT
TCTCGACATATTTGGTTTTGAGCACTTCAAGCACAATTCCTTCGAGCAATTTTGCATCAACTACGCAAATGAGAAGCTTCAGCAGAAATTCACCCAGGAC
GTATTCAAGACCGTGCAGATTGAATACGAAGCTGAAGGTATTGCCTGGAGTCACATCGATTTTGCAGATAATCAAGATGTGATTTCTGTGATCGAAGACC
GTCTTGGTATTATTTCGCTGCTGAATGACGAGGTGATGCGTCCCAAGGGGAATGACGAATCCCTTGTGTCCAAGCTGTCAACTATCCACAAAGACGAACA
AGACGTCATTGAGTTCCCTCGCACATCACGCACGCAGTTTACAATCAAGCACTACGCTGGGGCAGTTACGTACGAATCACTGGGCTTCCTCGAAAAGCAC
AAAGATGCACTTCTCCCTGATCTTTCTGACTTGATGCGGGGTTCATCCAAGCAGTTTCTCAGGACAATATTTACCGAAAAGATTGGCAGCCCGGTTTCCT
CGCGCAGGAaaagcaacagcaatgcTCGAGGTCTTGGTGGTCGAGCTATGGGTGGTGCTCTTACGGTGGCAAATGTTGGCACCCAATTCAAGGACAACCT
CAACGAGCTCATGACTAACATCCGGCAAACGAAGGTTCACTATGTCCGTTGCATTAAGCCCAACCAGAACAAGAGTCCGAACGAAATGGATCAGCCGATG
GTGGTATCTCAATTGCGTTGCGCTGGTGTGATTGAGGCAATCCGTATTTCGCGTGTTGCGTATCCGAACCGACTGCTGCTAGAGGATCTGG