Description :
From Genome Similarity Track
Location :
Scaffold_22:70563- 73056
Sequence
2493 bases(100 bases per row)
ACGTCTAGCGGTATGCTGGAAGTGGCTAGTTATGCCACAGGGATTAAGTAATGCCCTTGCTACTTTCAACAGATGCGTTACGAATCTGTTGAGATCTGTG
CGAGAATTCGCACCTAGTTATTTTGATGACGTGTTCGTCCAAAGCCGGGCTATGGATGGACAGACGGATGTGGAAGTACACCGACTCCACGTCCGAAAGG
TTCTTACACTGATGCGTGCGCATAAGTTATACGCCAACCTCAAGAAGTGTATATTTGCTGCTAGCGAAATACCCATTCTTGGATGCATCGTGGGTAAGCA
CGGCATCCAGCTCGATCCTGAAAAAAGATCAAGGCGATCACTGACTGGCCGGTGCTTACCGACATAAAAGGAGATCGAAAGTTCCTTGGCCTAGCGGCGT
ATTTGTACAAATACTCGCACAATTACGCCGAGATGACTGTCTATCTCTCTCGTTTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTAATTATCAGCA
CTCCTTCGAAGGTATCAAGCAAAGCTTGATACACTTGCCAGTTTTGGCGATTGCAGACCAAGACAGACCATTTAATGTGGTCTGCGATGCAAGTGATTTT
GCCATCGGATGTGCACTAATGCAGTATGATACAGACGGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCTGAAACCGGCTGAGCGCACTACCCGGT
CCATGACAAGGAACTCCTTGCCATGAAGTATGCTTTGGCGAAGTTCAGGGTCTACCTGATAGGCGATAGACCCTTCATCGTTTACACAGACCATGCATCC
TTACGCACGGCCGTCGACAGTCCACACCTCTCGCAACGAAGGGCGATGTGGCTGTCGTTCTTCGCGGAGTATAACTTCTTCGTGGAATATAAGCCAGGAC
GACTGAATGTCGTCGCTGATGCTCTGTCGTGCCGGATCGATTTTGAACCGGCTGCGCAACACGACACTGGTCCGACCACTGTAGCGGTGTTGACGTTGAG
TGTCCCGTCGTCAACCTTATTCGAAGACATACGCGAGGCGTACGATCCGGCGATGGTTAGCTTGATGGATCAACTCTCGCAACCATCCCATCAATCCCTT
AAAGGGTTACCCCAAGTATATCGATCCTCCACGGATAGATATACAGTCCTCAATGGCTTACTGAAGTATTCAACCGTTGCCGGCGACACGCCTCGTGTCG
TCGTACCGGACCATGGTGACCTGCGACTGCGCATCATGTACGAATATCACGACGCACCTACTGGTGGACATCGTGATCGAGAGAAGACACATCTCACAGT
TAGTCGCGACTTTTACTGGCCCCGCCAGTATCAGTTCGTGCGTAAGCACGTCCGCGCATGCGAAGTATGTCAACGAGTGAATTCTGGTCCTTCACTTCAT
GCGCCGTTGCAACCCTTGCCCATTCCGGCGGAATGCTGGGAACCCGTCTCAATGGACTTTGTCTTTGGATTCCCCGCAGACCCACACAAGAATACCGGTA
TTCTTGTGTTCGTTGATAGATTCAGTAAAATGGTACACCTGGTCGCTGTACCTGAATCCATCAATGCATCGGCATGTGCTCGTGTTTTTATTGACACGAT
CTTTCGTCTTCATGGGTTGCCTCGTGAACTCGTCTCCGACCGAGACCCACAGTTCACTGCTGAATTCTGGCGATCCGTGTTCAAAACACTCGGAACTCGC
CTTCAGATGTCGACCTCTGACCACCCTGAAACATATGGTCAGACAGAACTTGCCAACCGCGTTCTTGAAGAAATCCTTCGGGGTTAAGTCCATTCGTTTA
CGAATTGGAGCGAATTCTTGCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCGTTCATCGTGAATGTCTTGCGCCA
CCCAGCGCCTACCCACCTTCTTATAGTGTAACTCTAGTTTGAGGGTGGGAGGGAATCATTCGAGCGAACGCCAAGTCGGCTCTCGCTCATCACGTACTGA
CCACGAGGTCACTACGTATGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGGAAAGTAAGAGCGAGGTGCTCTTACTACCCAGGTCACTGATC
TTGCCGCAGTGCGCTCCAAGCGCACTATAGCCAAAGACAGAGAGTCAGCAGATGAATTCATACTGGCTCGCGAAACGGTTGTCCGTTTCGTGCAAGATTC
CATTGCTGAAGCAGTGGACCGACAAAAGAAAACGCAGACGAGAATGGAAGGGAAAATGTTCTTTCATTCAATGAGGGTGACCTAGTCCTACTATCTACGG
TAAACCTACCTCGACACATAGTGACTAACGTGGGTAGTATCAAGTTACTACCCAAGTTCATCGGTCCATGTCGTGTACTGCGCCGCTTAGGCAACGCATA
CACGATTGAACTGCCACGTAAGATGCGCAAGCATCCTACGTTCTACGTTGGTCGCCTTAGGCCTTATCACCAGTACGGGACTTCTTCCGGCGA