Description :
From Genome Similarity Track
Location :
Scaffold_928:7056- 8271
Sequence
1215 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTTGAACTTGGGCGGTGAGAGTAATCCCATGCC
TGCAGAATCAGATGCGATGCGAGACTGACGCGCCTAGCATCTCCGTTCGGACGGAGGCATTTGGTCCATATAGAAGAAATTCGCTTACCTTCGGCAAGCT
GCAAAGACGCAAGTTGCTCGGCGCAATTCTTACAGTTCGCTTGTGCAGCGGATACGGCGACACATGCGTCGTCGGGGACGGTGTTTATCGTGGCGTTATT
TGCACGGCTCTGCGACGCCGGCATGTTGGTGTTGCTCGCGCAACTTATGTTCGCCTCCTTGGCTGCTGCTGATAACTGCTGTAACNAGCACTGATGGCTT
TTCCAGCGTCGACAATCATGTTGCCGCCTCCAGCCGGCTGCTGGTCGGGTGCAATCTGGCCTGTGTTGTAGTAGTACACAAAGGTCTGACTGTGGGGTGC
ACATATATTCTCTCTAAACACATGGATTATGCAATTAGACAGGCCGGCGCGTTGATTCAATGAACCGCGCAAGGAAATGTTGAGTAGAAAGCGCAATAGC
GCAGGTCAAAAACTATAAGCTATACTATACAAAGTCGGGCTGCGTCCGAAGAAGCTCTGGCCATTTCGTATAAAAAGCCAAACTACATGCATGACGCGCG
GTAGTAATTTATGCCCGCGTACTACATGTACTTACTTAATGTGCACGAAGTGCTTGTTTCTCATTGTGCTTCGAGCAAGCACTTCGTGAGCTTTTGAGCA
ACATTGATTGTCACCACAGTGTCTTCTTCTGGGAGGACATCGGCGCCGTCAATGTTGATTGCTTTCAGTTACACCATATCTACACGATCATGGAACAGCA
GGAACACTATATGACAGACTCCTTCGAGAACTTGTCCTGTATCGGCATCAGAGTATTTATATTAGTCAGCTTGCACCTCAGTGCGATCAGCGCCTTCAGT
TGGTTATTGCCGAAGTAAGGCAGGTTAGTATCACCTAGACCAGTGAATGATGAGATCAGTGTCACCAAGGGTTGCCAAAATCTGCCCCAGTAGCTCTAGG
ACCTCCCGACACTCGTCCAGGTTGAACCTGTCCACACGATGCAAAAGCACGTTGGCAGCGCCACACACAGCAGCCGTATCTTCCTTCGCATTATCGTTCT
GGTATTTGGCCGCAA