Description :
From Genome Similarity Track
Location :
Scaffold_77:70558- 73919
Sequence
3361 bases(100 bases per row)
CGCAGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCG
GAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTTAAGAGCTATTGGGAGATGC
GCAAGGTGGATTACTTGGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTT
ACGAGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAAGATTACGCCCTGTTTGCCGCGGTGTTGTATGAATTAAGAGAGGTA
GATTTTGCTGCGATGACCGCTCCAGCTGTCCGGATGAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGGGATCCAAGTGGTATGACGT
CAGAAGAGGACCTAACACAGGAGCTGGATCCACTCCGAGACCAACAGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGA
ATCTCGGTGGATCCGAGCTCAACACGCATTTGTGGAACTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACG
GTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTGCAGGAACATGAGGGGATCTGTCATCCAGTCACCTTTGTCAGCCGGACACTGAAGC
CGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTTGCGCTCCTGCGCGTGTTGGATCTAAATTATAACCTGCTAGTGGGGAGATCCATCCGGAT
CCTGACTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAA
ATTGTGAAATGTTCGAAAGGGGAAGATGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCACTGACTAAGATCGCCC
CTAAGAGAGAGTGTCCCCCAAAGGGTCGGCCAAAGTCGATTCGATTCCGATTCCGAGGTACGGTGGAGAGATTATAGTCTGATTTCGAGGATCCGCTCTG
TAGAGCGGAGAGAGCTACGTGCATATGTGGAGATTGCCCGGATGGGAAGTTGTACGGGCCAGATCCCACTTACGCGGGAAGGCCTCACCGTCAATGAAGC
GGAGTATAACGGGCTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTG
CGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAGCACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCA
AGCGAGATTGGAATGCCAGTGCGGATAGCTTGGCCAGTGCCGCTTTACGGAATCAATGCGGCGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGT
TACGTTGAAAGTACTAGACGAAGTGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCAGTCACTAGGTCCAGAGGAAGGATTGGATCCAGT
CCCCAGATCCTCGAGGAAACATTTGTGAAGAGAGTCCGCATTGGGCGAATCCTCAAAGCACAGGACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATC
TGATGGGGGATGTACGAGACTTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGAATCTGAATGACTTGCTCTTCTATTG
CCCCCCTACGAAGAGAGTCAACGAAGATTGGGATGGATTGATGAGACTGGTGATGCCGAAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGC
TTGGAAGGCGGACATCAGGGCATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGAGGACTATTCAAGAGCGTACAACGATATGTCGGTG
AATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGA
CCATATCCCCTCGTTGCCCAAGTCGCTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGATAGTTAAGGCTAGTGCGTCT
AGAACTGCGCAAATCATTGCTGAATCGTACGAGGAGTGTGTTTTCCGAAGATTTGGAGCTAGCGAAATGATTCGACATGATCGGGAGCCAGACTTTATGT
CTGATTTCTTTCGAGTATTCAACCGAATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCACATGGTGCA
GACGATCACGAGAGCACTCAAGATGTATGTTCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATAAACACCGCCCAA
GACAGGATCCGGGGTGATACCCCATTTTACTTGGTACATATGTGGGATCCCAAATCCACCCTGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAA
ACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAGCTAACGGCTGCGGAGTGCGATACAGGATCGAGC
GGATCGACACAACGAAGACGCTCGTCCCCATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTG
GCCCATCTATGGCACGGACCGTTCCAGGTGAGCGAAAAGATAGGGGAACATACGGTGAAGTTGGAAACGGCAGGTACCGAGCATCGCCTGTTCCCTGTAG
TACACGTATCCAAGCTGAAGTTGGTCGAAGAATACCCGGATCGGCCGCAGGTCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCCT
CCTACCGGAAGATAGTTGGAATATGGATCTCGAAGACGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAGGGAAGCGAACTAGATACGGACGG
ATTTACCGATAATTTCTTGTGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGC
GGGATCGTACGAATCGTAACAGATTCGGCGTGATACAGTCTCAGGAAGAAGAGTAGGGAGG