Description :
From Genome Similarity Track
Location :
Scaffold_315:7053- 9435
Transcript NameFunction/comments
Albla_Nc14118530conserved hypothetical protein
Albla_Nc14118510conserved hypothetical protein
Albla_Nc14118490conserved hypothetical protein
Albla_Nc14118500conserved hypothetical protein
Albla_Nc14118520conserved hypothetical protein

Sequence
2382 bases(100 bases per row)
AGTAAACAGTCTTGTGATTCCGCTGACTGGAGCCATGCCAGATATGAAGACAGCAACCGCTCGCGTCTCAGGAGCAAAGTAATATGCTCGCTTTGACAAT
TTTGAAGGCTTTTGGAAGCTCGCACTGCATCCGGACTACCAGGAGCAGTTCTCAATCGTCACTGAGGATGGCGTGTACACCCCGACCCGTTTGTCGCAGG
GAGCTACCGACACTGCGATCCATTATCAGAGCCAGATGCATACAGTGTATACTCCATTGTTGCATGACAACTTGCTGGTCTGGATTGATGATATTATCGT
CTTCACTCAAACTAGAGAGGAATTTTTTGGCAAGACGCGCCACTGCTATGAATTGACTGCGCAGTATGGCCTTAAGCTAAGTGTCACTAAGAGTTTACTC
TTGTGTCGCGAGGCACTTTGGTGCAGCAAGATCTTAAGTGAAACAGGGGCACGACAAAATCCCGCTCGACTTGCCGCATTGACATCCCTTCCGGCTTTCA
GTAATGCAGCTGATCTTCAACGTCTACTGTGTGCCGGGAACTGACTACGTAATTCGGTCATAGACTTCTCTCTCAATGCAGCACCACTCTACGACAAACT
CGACGCTGTATTTTCGAAAACGAGTCGCACTAAACGCATTGCAGCAGGTAATTAATTGACTTGGACATCTGATGAACGTGACGCATAAAATGCTTTCCTC
CTTGCCCTCCTCCAGTCCGCTCAGCTTTCGTTCTCACAAGATCAGGCAACCGTCTGTGTTTTTACCGACGCCGCCAACTTTGCATGGGCTCTCATTGCTA
CTCAAGTTCTTATGTACCAGGACGACAACCCAGTTGAAAAACAAGCCCATGAGTTGCTTGGATGTATGGGTGGCATTTTCCGTGGAGCCCAGATTAACTG
GTCAGTCACGGAAAAGAAAGAATACCCGATCATTAAAGCGTGTATTCAACTCGAGTTCCTGCTGGATCGATCCCGTGGATTTCTCCTATTTTGCTATCGC
GCAAACTTGATTCACATCTTCTCGCCGGCTCAGTCCGTTAAGCGTCACATCCGTGGAAATCTGCAGAGCTGGGATCTCCATCTAGTACCCTACCGATATG
ATATTGAACATCTCAGCGGTGAGCGTAATGTGTTCGCTGACATTGTTTTTCGTTGAATTTCCCCACCCCAGCCTGTGAATGCCACTGCCTATGTTATGCG
GTTGCGCAGTGAACCACAGCTCTCACCACTCCACCCGCTCCAAATACTGGGGTTTGTCTACCCGTCGGTCAAGGAGATCGTCACGCATCAGCAGCGTTCA
TCAAGACGCCCTGCCCTTCCTGCAGATGGATCGCCGATCCTAGTAGAGGGGAGGGTATGGCTACCTCCGGACGCAGATCACCTCATCATGCGTGTCTTCA
TAGGCGGCCACCGCGGCGTTCACGTAATGTTCAACACTATCAAGCGAGAGTTCATGGTAGACAACCTCCAGCGCAAAGTGCAAGCATTCGTGAAGAAGTG
TTTGCTTTGTCGACATGTATAGGGTCAGTTGATTGTGCACCGAGATTGGTCGACAGCTGATGACGGGACCAAGCGCAATGAAACCCTTGTTATGGACTAT
CTCTATCTTGGCGATAGTATCTCAGGTGCTAAATATTGCCTAGTGCCTAATAATGCGTTCAGCCACTTCTGTGAGCTAATTGCTTCCGACACTGCAAGTG
CTCGGGTCGCAGCTGACACAATTATCAGTTGGTACAAGCGCTTTGGTGTGCCCATTTCCCACATGACCGACAATGGAACGCATTTTAGCAACCAAGTCAT
TGCTACTGTGACTGCTAAACTCGGTATGACGCAAAGGCTATCTCCACTCTACGCGCCTTGGCTTAATGGAGCTGTCGAGCGCGTGAATCGCGACTTTTAC
AGGTTGCACGTGCGATGTTGCTCGAAGCTCAGCTCGATGTGCGCAATTGAGACATTATACTTCCGGTGATTCAGTCCTGCGTCAACCATTTCCCCGTCGA
GAGCCTGGGTAACAAGTGCTCGATGAAGATCTTTACAGGTCTCCAACCGCCGCCGCCTTTGCTGGCCCCTTTTATCGCGCCTGATGGAGATGGCACCACC
GCTATCACGGTAAATACTGACTCGGTAGCGCGGCAGTTGAACCAGCTTACGACTCGTCTACAACAGATGCACAAGGTTGTGGAATCTAGCAAGCGTCATC
GTCAGCAAGCTGCTCGCGATGCATCATCCAGCGCTGCTGCCAACTTCCAAGTGAGCGATTTCATATTGTGGTCGCGCGTTGAACCTCGTTTGTCGGGCTC
CAAGCTTATGTTCCGTTGGGTCGGCCCCTTTCTAGTCACTGGGATCAAGAAGCACTACTTTGAAGTTGAAAATTTGATCACT