Description :
From Genome Similarity Track
Location :
Scaffold_57:70512- 75638
Sequence
5126 bases(100 bases per row)
ACGCTGGATGATCAACCAGTGGTACCGCATATGCTATAATCTCTTATTCTTCTCGATCTAAGTTAGCTTAAAATGCCAATGTTTGCCATTCCATATACCG
CTGCGATCCAACAAATACATATCCCTGTGATCGCAGTATCATATCCGCTGTCATCCACAACGCTAGCGGAGCCCTGTAATTTAAACACACATCGCGATTA
CATATATTCGTAAGCTGCAGAAACATTATCTTGCCAGTTTCATTTGTCACTGTTGGAACTCACGCCACATCCCGCCTCACCCAAAGTTTGGACTTGGGAG
GATTAACGCCGACCCTGACTTCAGTCAGTCTACCGGCAGGGATGACAATATGTTGATACTTGAAGTTGATCGCCGATATTTTCGATCGGTATGGCGGTCT
CCGCCCAGCCAAACAGATGTGAACTTTGGCCGTAAGACACAGGGTTCCGCAGGCCAAATCCAAACGGATGTCTGCCGGAACTATGAAGCCCATACCCAGT
ATGGCTTTTTGACCAACTTGATCACCAACACATCGTCAAAAAGTATACTAGCGATCCGTCCAATGTGATTTTGATCTTGGTCCTCCCTATCGTCATGTAG
GCATTCTCCCCTATCCCAACAATTTCTCGCGTCTGGCTCTCGTCGATAACACATCGTACCTTACGGGCAAAGGTTGTGTCGATAATCGGAATTCAGCACT
ATAGTCGAACAGCATTGTGAACTTTTCTTTATTGAATTTGCCCACTCATTTCGCTTGCTTGAACCGTTTTGCCGGGGTGTGATACCCCCAGTATCCGCGT
GATCCTTCTGGGGCGAGCTCGAGCTCCAACTTTACAGGAATACGAGCATATTCGTCCACTTATGTCACACTTGATACGGAAGAGACACATGTAGAACGAT
CACGTATATTAGTGACCGGATAGCTCCAATTCTTAACACCTTGATCCTCTAATCGTCTTTCAACAAATGCACATATGCATAGCCTAGAACGCTCGGCTCG
TGCCAGATTCCAAACTGGCGAGCTTCCTAGCTTCACATTTCCTTGGCCTTCAGAGAAAACATCCCAGCATGCTTGGCGGGCACGTACCACTTGCTGACCA
AGTTGTAGAATTCTTTCATGGGGCACTTTCCACCCTCATGCATCTCTCCACAAGCTTCACACACATAGAAACACTTTCCCGATGGATATCCCTTGCGACC
GCATATCTGACACGTCAATTTCTGCCAGAATCCACAATCGTCGTGTTTCTATGATCCGCAATGAGTGCAGGCTTTATTAACCGTGGCACGATCCGAACTG
TAATCTTGACTATTCTTATCGGGTGCAGTACGTTGATCTACGATTGTCGTCGTGCGATCCGAGGTAGCGACCACTACCACATTTCGTAGTACTCTTTCAA
CGTCCGGTGCTCTGAGATCATAGTCTGAATAACTTTTACAATCCTCCACGAGAATGTCCCTCACAGGACGTGCTAGTTTTGCTGGTGTTTAGGAACCGTG
GGCGCAGATCGTGGTCAAAATTTATCCGATCACATAAATGCTTAAGCTTGTCGATTCTCCATGCGCTTGAAAGCGCGTAAGGTCTCATACATCTTATCCG
CCGCCCTGGTCCTTAACAGCATCAGTTGCTTGGTCAGGGTCCCAGTAAAATGTTCCACATGTTCACGACGTATGTCTGGGGATCCCCCTCGAATTCCTAT
CTTTGCTCTATTTGCTGCCACATCCAAACGATACGGATAGTTCAGAGGCATTACTTCCGGTCGCTTCTTGGCCAGGTAATATTGTCTTCAAACAGACAAA
CCATTCTTTCCATAGTGCACGAGAAAACTTTTCAACAGGTCCTACCCTGAATGATGTGTGGATCGGCTTAGCTGACTGTGCCAATTTTGCGCAGGACCTG
TAAGCAGATTCTCAAAAACCAAGCACTTCTCCACATCTGGAGCCTGATAACGTAAGAACGCAGACTTGACCTTGTCGATCCAGCTTGTGCCTCGATCTTC
ATCTTTGTCCTTTCCATTGAACTCGTTCAGTTCTGCGATCGCATACATCCAATTTTGCGTGGTGCGAAGTCGACCACCTGGTGCGGTCTCCGCAGTTGCC
GCGGGTGGTCGTCTCAACTTGTCTTGCCCGAAATCGTCAGAATCTCCTTCTTCACGGTAGTAGATGTCAGATCTACCGTGCTGAAATCCAAATGGTTTCA
TCTCAACATCAGGGGTGTATGTCTCGTGACCCTAGCAACCTTGATCCTCTGACTTAAGTATATCGCTTGGCAGGCTTGGTTACTTTGTTCCTGCTGAAAC
GATTGCATGGCAGCATCAAAATATGATTGAATTTGTCCTTGGAGTATTCTAACCCGCATCTACTTAAGCGCGTACTGGTGCAAATCGCGGTCCGCTCTCA
GTCCTTTTCCTACGACCACGCAGATCGGGCCTCGTATCCATGCGATCGCGCAGATGGGCATCCCCACTTGGACCTAAAGACATCCGCTAAATGCCAATTG
AGTCCCCTGATTCTACTCAGACTCAGCTGAGTCATTCTATGATGATTTAGTGTGATATCCTCTCCGCACTTCCGCAGCCGTCGGTACCACGTGATCGTTC
GCTGTTGTCGGTTGCACATGGTCTTTGAAGCTACGTTTTGCCCATCAATAAGACTAATTTCTCAAACAACGATAAAAACGCGTGCATAGCGCGATACTGC
TCGTAGTCCAACATTTTCATTGCGTCTAACACTTTGGTGACGAAACCAGCGTCATGTAGCAACAGTAAAATCCGGTTGATCTCGTCCAGAATGTTAAACG
CTACCGCCGGAGGGGGTATCGGACCTTGGATCACTCCGATCAGCTTGGGCTTCAGAATCCGGAGAGCTGGGTCACTTGATAGTAGATCGTTGAGTGTCTT
CTAGTATAACCTCTTTACCAACTGATCCAGCTGCCAGTCATCCATCTTCATATTGTTGTCCACAAACTCGATCGTTCGATTAATCGATTTCAAGCTGCAA
TCGTGCTGATCCGATCTTGTCGCTTCTTTCTTAACCCGTGCTTTCTTCACGTTATTCATCTTTGAATTTGCTCCAGTGGTCCTGGGTGATAGCTGTTCGG
TTTTATCCGAAGGATTTACATCCAGCGGATCGGGCTTTGCAGCATGTTCCGCGGTGTCTCCGAAGGGACCTCAGAAGGGGGTTGAAGTTTTTCTTCCAGA
TCGATCGATCTTCCTCTTTGATTTTCGTGTCATCATAGCCCCTCCCAAATCTCCGATTATCTGGAGATCCGTTAAAATCACGCGTTTGCGGCAATCCCTA
TGCGTCTGACGGCTTAATCCCAGGTTTAGTCTTGATCCTGACATCTTCTCCAAGGGACTCCCGGTGAAACTCCGAGTCACCAGAAGATCCGGTCAAGCGC
ACCAGTGTGGTGGAGTGGCGATCGCTCATTTTCTGAGACGATCCTGAATATCTCCTAACGCCCAGACGACCAACTAACGGACGGGGTACTCCATTACCGT
GCTTGATTCCTTTATCACCTTGTGTACCCGTCGGTAGGGGCAGGCTGCACTCTTCTCGGTGGACTTGTGCTGGGGGAAAACTTGACCGCTTTTCGGATGG
GGATAGGAGTTATCGTGCGAAACTTTCACAAATTTATGGGTGTACTGGTAGGGCGCTTGATATAAGTCACCCAGATCTCAACGAGATCGCATTTTCCAAT
ATGTAGATGCTTAAAACATTTAAACTTCTTACCACTTGAGCCGTCTCGCGATCTTGCACCTTGTCCCTTACGTTGTCGCTGGGTCTGATCGCAGTCGGGA
TGTCTTTAAAATTCTTGATCCCCAGCCGATTATCTGGGGATATTACTTGGTTTCACTATGTGAGTCTTTCTTGACTTCGGGAGGCCATATATATACAGCT
CGGAAGAGAAGCCTACACGTGTACTTAGAAGCAAATTGAATTCTGTTTAATGTTAACCAACCAAAAGCTAAAACTATCATTAATGCCTGTCTGTATACCA
GGATATGCTGCCTCGTGTCTTCGATATTCTGTTGATCGCTCCTTTGTATATGTGGTCCACTCCTGATCGTTGATCACTTTAATCTTTGATCATCATCTTC
CATCATCGATCACCATCCCTGATCGTGATCCCTAACAACCGTCGGTCACCTTCCCGACTCGCTATTACCCTCAATCTCTGGTCGTATTCTCAACCTTGAC
CACCCTATATGTTCTCGAGGTTGGTATCTTGACAATCAATCTTGGTATCTTGACAATCGAAATTGGTGTCTTGATAATCGATCTTGGTATCTTGATAGTC
GATCTCTGTAGTGCTCATCCTAACAGCTAATCAATCCTTCTCTACGATCAGTCGTAGCTTTCGACCAATCAACCAATCGATCACTTAGAGTTTTCTCAAA
TCGGTTTACCACATCACTGTATAAAAGTTATCACACAGCAATCGGGGTGTTATTGATAAAATCTCACTTTAGATCGGTCCTATCTGACTTGAAATCTCTT
GATCTTGTCGCAGACGCTTGATCCTACTTTATCTCAGCTCTTACATAGTTGTATGCTTGATCTTACCGATAAATCACTTCGAGGTTGTCAGATTGGTATG
TGCCAAATCGGTATCTGCCAGATCGCCCCTGTCAATCTTGGTCACCCAGTTCCTGTCTTCGTTTGATGAATCCAATATCAGTTGTCTCGACTTGAGAAAT
CGCGCAATTCGGGCCAAAAAATCTGGGATCGGTCTTCGCGATCTTGGTCAAATGATTCAAGATCGGTCTTCTGTGCGTTGGGACACGTGCGCCTTCAAAT
ATCGGGAAACCAAAGATGAATTTTCAGGAGAACGGGGGCACGTGTCTTGTGAAGAAAGGGACACTGAATCCTATTTATTACTAATCAAATTAATAGCGAA
ACCGTTACTATGCTTACCCTACCCGGCAGAATACTCATCCTACTGATATCCACTTCAGCCAGGTCGTCTTCTCGACACACGTTCCAAATTGTGTAGCTTG
TATTCCAACTATAGAACCAATATGCCCGATATCACGACCAAGTTTCAAATATGACTACCAAAATCAAATATGATACCAAATATGATACCAAATCCTCAAT
TTTGTACCCAGTACCCAATATCATAC