Description :
From Genome Similarity Track
Location :
Scaffold_1858:705- 1783
Sequence
1078 bases(100 bases per row)
GACTTAAACACCCACTCCAGCGTGGAGAAACGGGTGTAGACGTGAAGCGTCTTTCCCGCCAAGAGAGTGTAGCACACTTTCAGCAATTGCAACAGCGCGA
CTACTTCTTTCTCAGCGGGATGATAGCCGAGTTCGTTCTCCTTTAGTACGCGTCCGCAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGTGGTTGCATCAA
TGTACTGCTCAGTGCCCACTCATTGGCGTACAACATTATATGGACTTCTTTCGCCGAGTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTG
AGCTCGGCGAATGATGCTTTTGCTGACGCCAGGTCACCCCCAGGGCCAAAGTCCGTATCGTTTAGCTGATAGAGTACTGCTCCGTAAACAGCTAAGTTCT
GGATGAATCGGCCGTAATAGTTGAGGGCACCGAGGAAAGCTTGCATCCCCTTCTTTGATTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGC
ATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGTTGGACAAAGATACTCTCGGTAAAGCTGATGCTAATTCGACATTCT
GTGAACCGGGCTGGTAATCAGTCGAGTGTCTCTAAGCAGGCGTCGAACGTCTCACCTCCAAAACAGATATCGTCGACAAACGACCTCCGCTTGAACACCG
GAATCAAGGAAGACTGGTCTGGTTCTCCATTAGCAAACATGTCGCCGTCCGGTCCGTTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTG
GTCAGCTTCAAACTTCGTCAGCTGATTCTGCGTTGAATCACTGACTCCGCCGAGCTCAACTCGCCGAGTTCCCGACTCGGCTTCAGCAATAGTCATTCGT
TCGGCAAACAACTGCCATCCTCCCTTTGGTTAAACGTATCCCCATAGAGCGTTGTCGATCAGTCGCTGGTAAATTATAGGCGCATACTTCAATCCAAACG
GCATGCGTAACCATTCAAAGTGTCCAAGTGCACAGACGAACGCTGAGATCTGCCGAGAGTCTGGTGACTGACGCCACC