Description :
From Genome Similarity Track
Location :
Scaffold_156:70495- 72316
Transcript NameFunction/comments
g7330.t1hypothetical protein

Sequence
1821 bases(100 bases per row)
ACATGCACGAGGCGCCGCTGCTCAATGTGCTGCGCCAGCGCTTCGAGCGGGACCAGATCTACACGTTCACAGCAGACATTTTGCTCTCGATCAACCCGTA
CAAATCTATTCCGCTGCTGTATGACGTCGTCGGCTTCATGAACAACCGTCAGGAAGCTGCTACGGCCACTGGAGACGGCTCAAACAGCGACAGCAGTGCG
CCGCCACATTTGTTTTCGATCGCGGAGAAGGCGTACACAGGCATGAAAGGCGTCGTCCCGGGCTCTGGCGCTCCACAGTCGATTGTCATCAGCGGAGAAA
GCGGTGCCGGCAAGACGGAGGCTTCCAAGTACATCATGAAGTACCTCGCCACAGCGAGCAAGCACGTCGCCAGCACTAGTACCGGAAAGGCGGCAGCTGC
TGCTGCAGGTGTTCACGAGCAGATCGAGGAGTGCGTCGTGCTCTCCAACTTAATCCTCGAGTCGTTCGGCAACGCCAAGACTTCGCGCAATGACAACTCG
AGTCGTTTCGGCAAGTATATCCAGATCCACTACAGCAGCGAAGGCCGCATGGCCGGGGTCTCGATCCGCCACTTTCTGCTGGAGAAGACGAGACTCGTAC
GCCCGGAAGCTAACGAGCGCAACTACCACATCTTCTACCAGTTGCTAGCGGGGCTTGATTCATTGACGAATACAACGTCAGACCCTGCAGACTCCGATCG
GCCACTACTGCTGCGGAACGACGTGTGGAACTACACGTACCTCACCCGTGGAGATTGTGTCGAGGTGGACGGAGTGGACGATGCCACCGAGTTTGATCAG
CTCCGACGGTGTCTGGAGCAGCTTGGAATGGACAGCGCCAGTTTCCAGCGCCCTATGTTCGAGCTTCTGGCAGCCATTCTTCACCTCGGCAACGTGCAAT
TCGAAAGCTCGACAACACAAGATAACAGCAATGGAGATGATCGTCGAGAGGACGAGCCAACCAGAGTTGTGTTCCCAGAATGTGATGCTGGTGTGAACCT
TGAGCATGTAGCGATGCTGCTGGGTGTCGACGCTACGGAGTTCGCCAACAAGATGGTAACACAAACCACCGTTACCGGTCGCGGCAGTATTCTGGAGATC
AAGCTCACCCCTGAGCAGGCCAAGAATGCCATGGATGCTTTCTGCAAATATCTGTACGGCGAGCTTTTCCACCATGTGATCGCGCGTATCAATGCCTGTG
CCAAACAGCAGACATCCCTTATCCCTCCTACAGCCGGTGCCGACAAAAAGACGCCAAAGTCGCGCGGCGCAACGGCGCCATCCGTGGCTCCGTTCATCGG
AATTCTCGATATCTTCGGGTTCGAGGTGATGAAGCGCAACAGCCTCGAGCAGTTGTGCATCAATTTCACAAATGAAACACTGCAGCAGCAGTTCAACAAG
CACGTGTTTGTGCTGGAGCAGGAGCGATACGCTCGCGAGGGCATCGCAGTGTCCCCTGTGGAATTTCAGGACAACCAGCGATGTCTCGACTTGATCCAGA
AACCGCCGCTCGGATTGTTGCCACTACTCGAGGAGCAGATGCTGCTCAAGCGCAAGACCACGGATAAGCAACTGCTCACGATCTACCACGGAAACCACCT
CGAGAAGCACTCGAGCTACGCCAAGCCGCGCTTCGAGTGCGACGAGTTCATCATTCGCCACTACGCAGGGGATGTCATCTATGACATCCACGACTTCATC
GCCAAAAACACCGACAATCTGCACGAAGACTTGCTGGACCTGCTGCGTCGTAGCTCGCAGCCGCTTCTGCAAACCATGTTTAACGTCCCCGCTGCGGCGG
CAATCGGTGGCGCGGCAACAA