Description :
From Genome Similarity Track
Location :
Scaffold_379:70487- 73614
Transcript NameFunction/comments
Aphin_H310_07006nardilysin putative

Sequence
3127 bases(100 bases per row)
TCACCCAACGACAAGAAGCACTATCGCTTGCTCACGTTGGAGAACGACCTGCAAGTTCTGTTGATCCAGTTTCAACCTAACACAGACGATGACGATGGCG
GCTGTGACGAGGATGCTCAGAGCGGAGATGACGACGATGACAGCGACGATGGAAAAAACGACGGACAAGACGAAGGCTCTGACGACGAAGATGACGACAT
GGATGCGAGTACCAGTGGACGGCGTTCGGACGTGTCGATGGGAGGTCATACCAAGGAAAAGTCGTCGTCCAGCCGTCGTGCAGGTGCATGCTTGACAGTA
GGCGTCGGAAGCTTCTTCGAGCCACAAGACCTCGGGGGCTTGGCTCACTACTTGGAGCACATGCTGTTCATGGGTACGACATGTTGTTCGCGAGTTGCGC
TGTGAACACCAACATCCATAGGGAGCGAGAAATACCCCGATGAGAACGAATTCGAATCGTTCTTGAGTGCTCATGGCGGCTACAGCAACGGAGAGACTGA
CTGCGAGCGCACGAGCTACGTGTTTGAGGTCGGCCCGGATCACTTGGAGCGCGCCCTCGACATGTTTGCACACTTTTTCATTTCGCCACTCATGAAAGCC
GACGCAATGGACCGAGAGTTGTGCGCCATCGAGTCCGAGTTCAACCAGGCGACTCAAAGCGATCAAATTCGTCTGCAGGTACGTCGGTATTGCCTCGTGC
TTGGAAGCTGACCATTGCCGTGCAGCAAGTTCTCGCTGCCACGTCCGACGTAACCCATCCGTTCCATCACTTCAACTGGGGCAACATCAAGTCTCTCCGT
GATATCCCTCTGTCTCAACAAATCGACGTTCGCGCTAGAGTGCTGGATTTTTACAACACCCAGTACTCCGCCAACCTGATGAAGCTCGTCGTGTGCGGCC
ACGACCCACTCGACGACATGGAGTCGTGGGTCCGTCGATCGTACACCCCCATCAAGAACAAGTATATTGCGCCGCGCTCGTTTGCAGCACTGCCCCCGCC
GTTCGGCAAATGTGCCGATGCCCGCCCTGCACAATGCAAAATCCTTCCGCTCAAATCCATCCACTCGGTCTCACTCTTGTGGTTTCTGCCGCCCTTGACT
GGCCACAACCACCTGAAGCCGCACGATTACGTTGCGTCCATCTTGGGCCACGAAAGCGAAGGATCGATTTTGTTTTTGGTACCCGTGTTTTTCGACCGAT
GAATCACGCAGACTGACCGTGTCGGTAGCTCAAGAGTCTTGGGTGGGGTCTCTCCATGTCGGCAGGTCTCACGGAAGATCACGGCTACGACTACGGAACG
TTTGGAAGCGTCTTCACGATCGAAATCAAGCTTACGCTCGATGGCCTGGCGCACTATACCGACGTAGTGACAATCGTGTTTCAGTTCCTCAGCATGATGA
ACGCGAGTCCGTTGCCAGCGTGGATATTTGACGAAGCCAGGGCCATTTCGGAATTGAATTTTCAATTTCAAGAAGATCAAGATGCAATGGAACAATGCGA
GGAAATGGCCGCGTTGATGCAGGTGCGACCACCTCTCGTGCTGGGCGAATACAAAGAAAGACAAACCGGACTGCCATGCCTGACTCGAATCCTTGTCGCG
CTAGGGCATGTACCAAATCCCTGCGCAAGACCTCCTGCAAACGAACGTGATCAAAGGGGTTTTTGATGCAGCGAGTGTGCACTCAGCAGTCTTGCAGCAC
CTGACGGTCGAAAACGTTCGCGTGCATGTTGTGTCGAGCTCATTTGCAGATGCGGCCGTGGCGTTCAAGGTACCGCTTCCCGCTGAGAGTATGTTGTGCG
CTGACTCGATTGCGCGTCAGGAAGAAGAGTGGTTTGGGGTCAAGTACATTTACGAGCCGATCACGTCGGATGTAGTCGCCGCGTGGTCCAACTGCGGCGT
GAACGCCAAGCTGCGGTACCAAGACCCGAATCCGTTCATCCCGACCGACCTGTCTTTGGTCCCGCTCGACTCGAACGACGATCTTGGAAACGCCCCTCGG
CGCATTCACGGCGACGCCGTCTGGTACCATTCCGGTGCGCCGTTTCGGACCCCCCGGGCCCACGTTGTGTGCTATGTGGCAAACCCGAACATTGTTGAAT
CTGCCAAGTCCATGATGGCCAGCGAGCTTTACCTCCGCCTCGTCAAAGACTCGCTGAACGCTTACTCGTACCACGCGCAAGTGGCGCAATTGACGTTTGA
TCTGCACGTCAAAGAGGCCGGGTTTGAGTTATTTGCATGCGGCTTCAACGATAAGCTCCCTCAGCTCGTACGTGTCATGGTGAACCAGCTTGTGGCTCTC
GACTTGATCGAGTCCCGATTTGACGTGATCAAAGAAGAGCTCGTCCGTCAATACCAGAACGCGCTGCACAAAGGCCAAACAAAGGCCAAGTTTTTGAGGC
TGCATCTTCTAATTGACACGTCGTTTTCGCACCAAGAACTCGTCAACGAGTTAGTTCCGTTCACTGTACAAGACATGCGTGCCTTCATCGCGCACGATCT
GTGGCGTTTAGGGGCCCGAGTCGTGGGGATGGTGCACGGAAACCTGTCGAAAGCTAACGCTATCGAACTCATCCACGGAATGTCCGCGACAATCGCCAAC
GTGGCGCCACCCGTGGCGAAAGGACACGAGTGGGTCCCGCGCCTCGTCCGTGCCATTGCCCCGTCGTCCAACACGATCGTTTGGGACACGAGCGAACACG
ACCAAGACGTGAATACAGTGTGCGAATTCTATTTCCAGATGACAAACCACACGATCGAAGGCCTGGCGCTAGCAGACTTGCTGCATTCGATCATGGAAGA
GCCGTTGTTTGACGTGCTTCGGACCCAGAAGCAACTGGGGTATGAAGTGTCATGCACGGTGCGAGTGACCCATGGCATCTTGGGGTTTGGCATTACGGTC
GTGTCGTCATCGACGACGTCCGCGTCGATTGCAGCCGAAATCGATGCGTTTCTAGACGGATTCCGCCAAACGCTCGACGACATGCCGGCGAGCGAATTTC
AAGCGCACGTTGACTCGCAAGTCCAGCTGAAACTCGAACCCGACGTGACCATGATGGCCGCGACCGATCGATTCTGGACGGAGATTTCGACACAACGTTG
GGCGTTTGACCTGAACAAGGACTTGGC