Description :
From Genome Similarity Track
Location :
Scaffold_24:704787- 705852
Transcript NameFunction/comments
Physo_133221reverse transcriptase

Sequence
1065 bases(100 bases per row)
CGTTCGCGGCCTTCATCGTCGGCCTGCAATAGCGCACAGCCAATTGCGTAGTCAGACGCATCACAGACTACGCTGAAAGGCTTCGTCTCGTCCGGCAATG
CCAGGACTGGCGCGCGCTGTAAGCTCACTTTGATGTCGTTAAAAGCATCTTGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGGAGATCCGA
CAAGGGCCGTGCCAGCTCGGCGTAGCCTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGCGACCGAGGTGGCGGCCAAGCCGCGAT
GGTTTTCACCTTCTCCGGGTCCGCCCGGACCCCGGCGCTGCTGACGAAGCAGCCCAGGACCTTGATCTCCTCAGCTGCGAACACACACTTGTCAATGTTG
GCGTACAGCTTGTTCGCCCGCATGACTTCGAACACACGTCGAAGGTGCTGGAGATGCACCTCCATGGCCGTCTGGCCTGCCTCGGCACGGCTGTGGACGA
AGATGTCGTCAAAGTACGTCTGTGTGAACGCACGCAAAGGTCGGAACAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTTAGAAAGCCCCTGAGG
CATGACCAGCCACTCCCAGAGCATACCGCTCGGCGTGCTCACAGCCGTGAGTGGGATGTCGCTCTCGCGCATCAGGATCTGGTAGTATCCGTCCACCAGG
TCCAGCGCGCTATACAGCGTGCAGCCGGTCATGTTGTTGAGCAACACGTCCTTGCGCGGGATCGGTGTCTGCGCAGGCACTGTCGCGCTGTTCAGCTTGT
TATAAGCATGAACCAGACGCCACTTTCCGTTCGGTTTGCGAACACAGAAGGTAGGCGTCGAGTGCCGGGACTTCGACTCCCGCACCATGCCTGCCTTCGC
CTTGGCGGCAAAGAAGGCATCAATGACTTCACACTGCTCCCGGGGAAGAGGCCATTGCCTCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCACG
TGCCTGATTCCCCTGTCCGGAGGGAGATTGGACGGTGGATCCTTGGACACCACGTCCTCAAACTC