Description :
From Genome Similarity Track
Location :
Scaffold_120:70465- 73021
Sequence
2556 bases(100 bases per row)
TCGAAGCGAAGGGCCGGCCACAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCTCACCTCTCTCAACGAATGACGAGGTGGCTGTCCTTCTTCGCAGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGT
GCTTGCGGACGCCCTCTCTCGGCGTCCAGACTACGAGTTGGACCACATCACACGGATGACAACGGATCTATATGATCGGATACTCATGGCGTATCGGGAC
GATGAGGCTGTCGCGCCAATCGTCAAGTTCCTCACGGCAGGAGCGAGCGCGAAGTCCGACTGGCTTTCGTCGCGACAACGCTCCCGACTCCACCGATATG
AGCGGACGGAAGGCCTCCTCTACTACTGGGTGGAGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACGAGGATTGCAAGTTCGATACCCTCGCGAA
ATCGCACGACGCATCCTCCAGCGGCCACTTGGGCCGCGACATGTACAAGTGGGTTGCCCGATACGTGAGGACATGTGGAACATGTCAGCGCGTCAAACCC
GCAGGGCACTCTTCGGCTCCACTACAGAGTCTGCCCGTATCGGCTGCCTATTGGAAGTCGATGACTCTTGACTTCATCTTTGGACTTCCCGCCGACGGAC
ACGGCAACACCGGAATTTAGGTGTTCGTGTGACGGCTGAGCAAGATGGTACATCTTGCTCCAGTACCCGTCACTGTCACATGCGAGCAGACGCGAGGCTT
TTCGTCGATGGCGTGTTCTGCTATCACGGTCTCCCGGAGATGACTGCCTCGAACCGAGACCCGCGGTTCACCGCTGCCTTCTGGAAAATGCTATTTTCTT
TTCTCGGAACTCGTCTGCAGATACCCCCTGCGGACCATCCGCAGACAGACGGCCAGGTAGAATTCGTCAATTGAGTGCTCGAGGTCACTCTGTACAGTGT
GAGCGCGGAAGCACCACGTTATTCTAAGAGTCTCCGGGGGCGAGGCTCGGAAAGCTCTTTCCTCACAATTCTCAGATGTAAGACCGGTTTCGCTGCGGAA
ACAAGCGAAATCTTTTGTGGATACCAAGCTGAGCGTGATCAGCAGAGTCCGCGATGCCATGGCAGCGGACCAGTATATACAAAATAAGTATTCAGACAAA
CAAGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGAACTTAGTGCTATTAGACACGAGGAGCCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACA
AGCTGAAGCACCGCTTCATTGGACCATTTTCAGTCCTGGCCAGACATGATGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGCT
CTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGTTGACTCGCGGACCCACCTTGGCCCAGATCCTCGAAGCGAGGGCCGGCCACAGACG
TCGTCGAGGACGTCGGAGCAGGCACCCAAGCCTCGGTCTGAACGGCAAAGTTGCGGTCAAGACCGTACGCAGGAGGGCTCCGTACGAACGGACTATGGAG
CCATACGCCGAGTACGTTGAGTACGCCGGGTACACACCATACGCGTACGTCTGGGAGTGCACCGTAGGCGGCTCCGGACGTGGCAGCAGAGCCTCAATCG
GATCATGCGAAAGGCCTCGTCCGGATCGAACGAAGAGGCCCGTCGGTCCACCCGCAGATGCAGGCTCGCGACCTCACGCTTCAACAGGTTCAGGCGGCCT
GCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCTGCGTCACCGTCAGTTCCCAGGTCAAGTGCAATTTCAAGCACGAGGACACGCTGACGGA
GGCGGTCAATTTCAGGGTCCTGTGTCGGACCCGCAGGAGAAGCACTCGGACGAGGGCACCTCCGCCCCTGCTTGACCGGAATAGAGAAGTCCACTACCAC
GTGGAGTCGATCCTCCAGGAGCAACGTGATCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATACCCAGTCCAAGAACTCGTGGGAGCCGATCG
AACGGCTCCTGATAGACTACTCGAATGCTGTAGTAATCTGGGAATAGAAACGGCGGTAACTTCATAGGTAGTCCGGGACTTCTTGCCCGAACGGGGTACG
GACGTTGACGACACTCCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCCCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGACCATGTGGGCAA
ACCGAACACGAAGATCGTGCTGGTCCAGGATGCGGGACAGCAGTCTTGACTTCATC