Description :
From Genome Similarity Track
Location :
Scaffold_94:70456- 71491
Transcript NameFunction/comments
g11214.t1ETI55284.1 hypothetical protein F443_02025 [Phytophthora parasitica P1569

Sequence
1035 bases(100 bases per row)
CGGGTGGCGAGCGACGAGCGACTGCAAGCCTGACGGGCCGCGTGACCTGGCCAAAGACCTGCCTTGTGATCAAGCAGTTGAGGTTGGCAGCTCTGGATAC
TGCGAGGTGCAAGATGTGCACTCGGGCGAATTGTTTCGTGTCATGAGAAGAACGTGCGCAAGCAACAAGAAGTCGCAGGTTTTCCGGTGCTCGGATGCCC
AACAGTTCGTCAACTACCATATTGAAGCCCTCGACGCTGTGAAGGCCGCGCTGGAACCGGGCTTCGCGCTGCCCAACGTAGCAGGGAAGGAGCACGGTCG
AGATGGAATTGTCATGGTGGTGTACCCCAAGCTGGTCGCGAGCGCGTATGCCACCATTCGCACCTTGCGCGATGTATTGGGCTCTCGGCTACCCATCGAG
ATTTGGTTCCGGCAGGACGAGATCGATAGAGTCCCGAGGTCGCTGCTTCCTCTCCAACAACTTGCGGGAAACGATACTCTCCGCGCCATAATCTTCCGTG
AGATCAACGATTCACGGGCTGTTAGCTTTGGAGCCAAGGTGTTCGCGCTGTATAACAGCGGCTTCGATCGGATCCTCTTCCTGGACGCCGACAACGTCCC
GGTGCGAGACCCGGCGTACCTGTTCAAGTCTGCTGAGTTCGAGAGGACGGGCGCCGTCTTCTGGCCAGACTATTGGCATCCGCACTACACGATCTTCCAC
CTCCATGGAGACTCGCTCCTGTGGGAGCTTCTCAGCATCCCGTACGTCGACATGTTCGAGCAGGAGAGCGGCCAGCTACTCATTGACCGGAGACGACATG
CCGCGCCGCTGGAGCTCGTGCGTTTCTTCACTTTCCACCAGCCGAATCCGATTGAGCAACTCAAACTGCTGTGGGGCGACAAGGACCTCTTTCGCTTTGC
CTGGATCAAGCTGGACGTGCCGTTCTTCATGGTCCAGACGCCGCCCGCTGTCGCTGGTAATGTGAACGGCACCTCGTTCTGTGGGATGACGATGGTGCAG
CACGATGCTCAAGGCGAGGTTCTGTTCCTGCACCG