Description :
From Genome Similarity Track
Location :
Scaffold_22:70451- 72211
Sequence
1760 bases(100 bases per row)
CCGCGGGCTACAGCACTAAGCTTTGGGATGCTCGACCGTCCAAATACTCGCGGAACATCATCAAGAAAGTCTGCGTCTTCGTTTTCCTCCTAACGATATG
CGAAGAAGTGGCCAGCTACGCTGTCAACCAATCGCTTAAAAACTTTTTCCAACGGCTCGGCTGGTCCAACAAGGGTTCCAACTCCATGAAGCTCACGTAC
GACTCGCTCAGCCAATTTGCGTGCATCCCTGCAGGCTACATCTCTGACGAATTCCTTGGCAAGTTCAAAACGCTCCTGGGCGCTGCATCCTCCAGTTCCG
TGGGTTTTGTGCTCATCACCCTTGCAGCCTTACCGTCAATTCGCGCCACACAGTCTTTGAGTCAGACTCTATTCTGTGTTGGTCTCTTCGGTGGTGTTGC
GCTCAACCAGGTGTGTCTTCGAGCGCTGACGGTCTCATTTGGCGGTGATCAATTCTCCATTAGAGCGCGCGAGTTTCTTCAGCCTCAACTTTTGGGCCTC
TCGACTTGGCATTTCTTTCAGCTACGCTTGTGTTCCCTTCGCTCGCTATCCATGGCTTTGGAGCAATCCCAGCCGAATACGGTTTCATGGCAGTCTATCT
GGTTGGTCTACTCATGCTGCTGACTTTCGTCGGAGTGATGCTGTCCACACGAAAGCGCTACGTAGACGTACCACCAACTAGGAGTGCTCTCGGTGCTGTG
ATTCGTGTCGTTGTCCGTCGCGCCAGACATAACTACCAGGCAAGGATGATTGTGTTGGGTACCATAATGTATCTCTCCGCTTTTCTGCTCAATTTCCCTG
CCGCATTCTTAGGGGATCATGGGGAAGTTGGCCACAACATTTCATACGCGTGCGGTGTCTTGACAATTGCCGCTACCATCCTCTACATCTATTACGCTCG
AGACCCCTCCTTCATCGATGGTGCCACCGATGCTCTCGGCGTCGAACTCGACCCTGAAACGATTCGTGGAATCAAGCAGGTCATCCGAATCCTCCCTTTC
AACGCCTTTAACATGTTCTGGTGGGTCTGCCAGAACCAACGCGGCAACAATCAGACAATCATCCAGGAGACCGATGTGAGACTAGTTAGCGGACCCGGCG
CCAGCCAAATTCCTGGCCCCACGGTCCAGATCTTCAATCCAGCTCCGGTTTCCTCTTCGTGCCACTGCTTGACAAGATTGTTTACCCGTCGTACGAGAAG
TATTTTGGCGAACCACCCAGCAGATATGGCAAGGTTTTGGCTGGATATATTGTGGCGATCATCGCGATGCTTTGGACGGGGTTCTTTAAAATCATCCGAC
GAAACTCCTCTTTGTTGACGTACGATGACTCCAATGGAGAGATGCAGTACATTTTGAATGACGACGGCGGCCAGCCCATGAGCGACATTCCATGGTATGC
TGCGATTCCTCAGTACTGTCTTGTGTCGTTGGCGACGGTATTCATTCAGATCTCCACGTATAACATCGGTTATACGGAGGTCCCGCTGAGCTTGTGTGGC
ATGTCAATCGCCTTGGGTTTCTTTATGAACTCGATGGGTAGCACACTTTTGTCCGTGTTCGTGCTGTTGTTCAGCAAGTACATACCCACTGACTTGAACG
ACGGTCACATGGAGTATTTATACTTTGCACTGGCGGCGGTGATGGCGATAAACACCTTCTTTTACGTGCTGGTGATGAAGGAAATGAATTTTGCGATGAT
TCCACCGGTCGATCGGTCGACAAAAGATCCGCTAAGACAGAGTCTGCAGGATCCAGAGTC