Description :
From Genome Similarity Track
Location :
Scaffold_16:704275- 707164
Sequence
2889 bases(100 bases per row)
GGTTTCTTGTACACTCTACCGTTTGTCGTGGGTTTTATTCGTGGGACTTCGGAAAGCGTGGGTTGTCGATCATGCCCTTAAGGCGTGTGGATGAGGAAAC
GAAGCGATCTAGTACTCGAAAATACGATGTGTCAGTTTTGTAAGGTCCCATAAGATGTCAGCACCTGTGCCCGTTATGTCTGTTGCGGAGCTTGTCGGCG
CTCTAGATACATTGAGTGCCCGGCTGAGTGCGTATTCAATAGTACTGCGGTGGGCTTGGTACAAAGTGCTTAGCGCATCGTGATGTAACCAAGTGTGCAG
AGCGATATGGTGGGCCCAGAGGCCGCTCAGGCCCTTCCCCGGTGGGTTGATGAACGTTTTACGCGTTTTCGGACATGTGTCCCTCGCGGAGGGTTTACGG
CCACATCGGCCGCGGAGGAGGCATTTTCCATGGATCATATTACGAATTTCCGTATGGTACACAAGTGGTTGAGGCGACAAGCTGCAAAGTTAGTTCTGCA
CAGTCCCACAGAGGGGGTCGGCGCTGGCGAATATCGACGGGCGATGACCGACACGTTCACCTTCAGTTTCAGGTCGGTCATACTCGTTGACTTGTCTTCT
ATGATTTCTCCAGCGGAATTGATAGTGATATCCTGTTCAATTTCTACAGAAGACGAAGTGCTTTCTCACAAGAAACTATGAAAAAAGTTGCCCTGCGTTT
GGTGCCAATACACCGATAATAACCGATCGTAGCGAAAGGTTTGCCCCGAAAAGGCGTGTACCCACGTCTGGCTCGATCGGTATATGATCATCGAGCCATG
CTACTGAGTCAAACGGCAGCGAATGCTCTTCAGAAGCGTGTGACGACGCGTGTATATGTTTGATAGCGGCACAGCTACTTCAATAGTACCCCGAAGTGTG
CGTCCATCCGAACGGGCACACAAGATCATTGATTAGGACTCCTAACAAAGGCAGCGCTCCTTCAAACCGACCACTAGGCTCAGCTGCTATATGAGCGTTG
TGGAAAGCTCCTGCTATCGTCTGTCAACACTTTCACCTTGCCGGGATCTATTTCTTCAATCTCGACAATTCGGGTCACTAGTGCCCTTGCACCATCGTAT
GCGCCCACGACAATTAAGCTTTCTGTTGAGCGACCATCGCCAGATTATGTGACAGAGTAAGATAGGTCATGTATGATCCTTGCATCGATAGAAAGACCCA
TGTCGCCCTTTGGAGCCGCACCAAATGGGCAACAGTTAAAGAGCGTTCGTTGCTAAAGAAGGATTTGGTGGTGGCGAAAGCCGATATTTAAAACGGGCGA
CTTCACGACGGAATTTTCACCGTGCCAAACAATAGATTTACATTCGTTGCAGGAATGATAACGACTCCATCCAGGTAAATGGTCCTGAATTTCTAGCGCC
TTGTTCGGTCTGGGATCTCCTTTGAACTCGCCTCGATAAGTTTGCACAAGTTGTAAGAGCTGCATATTGGATCGTCTCAAAAACGTGCTAAATCTGTCCT
GTTTGTTGCGATCGAGCAGATACTGGATTTACCCCGCAGTAATTGCCATCGATGGAGACGACTGTGGCTTGATTAAACATATGTGGATCGGGATTGCCAT
AAACGTTTTTTCGCAGTCGTGTTCAGACGTGAAAGTAGCCGATGACAAGCCAATAGTTTACTGGTATAGCACTTTTTCCAAAGCTGCTAATACTCATGTA
GCGGGGCCCTAAGCTGATCCCGCGTGCGCGGTCTACCGGCATCCCGTACGATCACCTGCCACTTGCGAAAATCTTGATGCATCCTGGATTCTTGGGAAGA
TCAGGTTGAGTTGTCACGAGCTGGTCATCATCGACACTTGAAAACTAAATATTTCACTGCTGTATATCGAGTAGCGAAAACAACCCATTCCGTTGTTGGA
CAAAGTAATCTCGCGTCCGTCTGGAACCAGCTGAGCTGCCTCGAGCTGAGACAATGGGTAGCATGTTTGCACGTTGTGTCGGCATTGCCCTCACATAGAA
ATCGACACGACCAATAATCCCGATACAGGTCCATGCAACGGCATTCTCCTTGTTTTATCGGAGATCCGAGGCTACACTGAGTGAATAAACGCGAGTCTGA
GAATCGCCGCACTCACAGCCAATCTCATGGTCAGTCATACGATTATTAATTCCTTAACGCTCACTTCGGCGTCAGCTACTACGAATAAATAGAGAGCTGT
AGTCTCTGGAGTTGGAGTAAGGAATATCTAAGCAAAACTCCGTATTTGCTAATAATAGATTTCCGAGTGGATATTTTGAGATGCTCCAATACTTAACTCC
AGTGGAGTTATGAGGGGCCGCTCTAGCTCCAAGGAGTCTATTTATGGAGCGACGGTTCGTAGCCCTCGATTAGCTCCATAACCACGGATAGCTCCAAAAC
CTACAGTTCTCTAATGAGCTACTTGGTAGTCTACGCCACGTTAACACTTTTATACCACCTGTGACAACGCTTTTCCAGCGCGTAACCCCTCTAGCGCGCC
AGAATCCACAATTTTGATCAGTTAAAGTATCTGCAGAAGCGAAAGACGCTTGGAATGGTATCTAGTAGTTCTACAGCAGTCCAGCCTTTACGCTGAACGC
TGTCGCATTTTGCGGTACCAGAAGTGCCAAACCGGCCCGTCGTCATGGACGCTATCGACTTCGAACTGTGCTGCCTGCTACCAGCTCGAAAACAAGTTAT
GCAGTGATTGTTAACATACGTAGTTACAGGCATGTTTTCACAAGGTTTGAGAAAGCTCTCCGCGATCTGGGAGCGCTACTCTGAGCCGGTTGCCCTATCG
TCTACCTCACGCACGAGGCTTGGCAGCAGTGGGTGGGATGGTGCCGTTTGATGAAATATAGTCTTGACTGAGTTTAAACAAGTTGAATG