Description :
From Genome Similarity Track
Location :
Scaffold_30:70411- 71495
Transcript NameFunction/comments
g9671.t1hypothetical protein

Sequence
1084 bases(100 bases per row)
TATGTCGCAGTGGTCTTACGATCGCGACCAGGACCGTGAAAATCCTCGTGACAAAACAACCATGCAGTGGCTCAGTGTGGACCGTATAGCAGAGCAAATA
CGGCAACTGGAAGAGCACCACGTGGAGAATGACTTTGATACGCTGGACTTCGAGACGCGAGCTGCCGCACTTGAAGCTCACTTTTTTCAAGCTACCGGGC
GTGATAGTCCTCCAGCAGGTTGGCAGTCCACTCCTGCTAAAAAGGTGGTTAGAGCTCGACCGCAGTCAGCATCACTAGCGCGGCGTGCTCCAGAAACGAA
TGCAACGAGCAATCGAAGCAACGAATTCGCTCCGCGCCAGCGTCCTCAATCAGCAAAGACCAGATCAGAGATGTCTTGCACAACAAATGCGACCCAGACG
CAGAACGAAGTAGCGTGGAAGCCACCTATCCAACAAAACCCTTCCAAGTGGAGAGAAATGCTAGCTCGCGGGCCCGAGTTTAAGCAGCGCACACTGCGCA
GACTAGAGCTCGAAACGTATGAGCTGCTGTACAATACTCTTCAGCAGCAACAAGCGGTAGAAGCAAAACCCAGGACCCGACGACGAAAGAGACGGAGCAA
TGAAAATGGAGCTGACAAGCCGCTAGGTCACAGCCCGGCACTTGCCTGTGGAAGTGGGCTCCATCTCGCTCGAAGTCGGAAGAAGCGGCAACAGGAACAT
GATCGCCAAATGATGCTGGGCAAGGGTCGGCAACCATCTCGCGCCAGCGAGCAAGATAAAGGCAAGAGTGCTAGAGAAGACAAGCAAGCTATCCAAGATA
AAACACGAAGGCGCAGCAAGCTGTTGAGCAAGAAACCCCCCGAGAGGCAGCTTCAAGAGCTGATCCAACCAGTAAACCAAGTCTCGAAACACGATAAACA
GCGATACGAATCCTCCTTGCAGCGCCAATCAAGTGCTCCTATAACGGCCAGAGTGCCATGGGTGCCGTCGGGTTCAGCGAGCTCGCTTGCTATCAGAGGG
ATATCGTCAGAAACCAGTGAAGCACATTTGACCCAAGAAAAACGTATCGCCCAAGTGCTAGAAGCTTTTCAAAGTCAGGCAAAG