Description :
From Genome Similarity Track
Location :
Scaffold_187:7041- 12415
Sequence
5374 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTCGTAGTCCGTTCAACGACCATGAACATGTTGGACGATGAGGGGGATGATTTTCATCCCACGGATGAAAGCTACTCGCA
TTTAAGTCAAATCGAATGAGACGCTGTTGAACGCTTGAGTTCAACGATAGGGCAAGAAGCCGTTGGCGCACTGCTGTCTGCCCTGGGGCCAGAAGGACAG
CACGCCACCATCGCCAAGTTCATTCAGAACGAACTTGAAGCCAAGCGGGAAAAAGTAACCTTGCTTCACCAACAAGGTTCTCAACAGACAGAGCTGTTGA
GAGAACATAGTGCTCAACAGTTTGAACTGTTGAGACAGCAGCAGGCCACTGCTACCGGGCCGACGTATACACGTCGACCCGAGACTCTAAAGATTGACAT
CTCAAAGTACAAGGGAGACGATGAAGACTCTCTGTTGAGACGGTTCGTGGAACTAGACGATGCCATAAGGGCTCATCATATCGTCGATGAGGAAATGCAG
ATCGCATTTGCTCAATTGAACTTGGCAGGGCGTGCAAAGACGTGGGCCTTGGGCCTTAAGTTACACGACCCATATGTCTTTGGGTCGTTGGAAGTCTTCA
AGTCCCTGCTAAGGCAAACTTTTGAGCTGCCACGAGCGGAGTTCAGGGCTCGATCTGAGCTCCTGAGAATCAAGCAAGGTAAACGTGACGTACACTCGTA
CATTCAGTACATACGTCACCTTACCAGTTGCATAACAGTCGACCCACTGAACCAACAAACGTTAATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCT
GTTAAAATCTAACTGTTCCGGTTGGAGTTCAACACCCTAGAAGAGGCAAATAAGGGTTGCGAAACAGGAGAACTTCAGTGTGAAACAAGCTCACGCGAAT
TCAAATTCCTATCGTCCATCGAGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTAACACGAGGAGCGAGAGCTCTCGTGTTAACAACTATA
AGAAATTGCAGAAATGCAATAGATGTCAGAATACAGGGCATTATGCATATAAATGCAGAGCCCCTAGCGCGGTACCACGTACCGTAGGAAACAGTAACCG
CCAAGCAGCCAAGCGAGGTCCAAGGCGTAGGTCCGACGTTGTTGTGAAAACGCAACAACATAACGGACAGCCAAAAAACGGTCAGGGTCAGTAGGTGCGG
AGCACCCTACTGATCCAGCAACTTCAAGTGAGTTTGCAGGCCTCTTGACGAAAGTTGCTCCCAACACTCAGTCATTATGTGTTGCTGCTTCTGGTAATGA
GGTTTCCCTCATTACCTTGAAATTCGAAGTGACACAAGGCATGTCGCTTCGAGCTCTAGTCGATTGTGGGACGTCGAACAACTTTGTACGACGCCAATCG
CTAGACAAAAGAGCTCGAATATGTTGAGCGAGAGATCCCTCCAACGAGGATGACGGTGCGCCTCGCGACAGGCGCATCCGTAACAGTGATGAAACGTGTA
GTGGGTATTACCTATACACAGAAGGGAGTCCAATACGATGATGACTTCATCATATTAGACTTGGATGACAAATTTGATGTCATCCTTAGACTGCCGTAGC
TCAGAAGGTACGAGCCACAAGTCAGCTGGCATCGATGAACAGTTGATATGCCTGTCACTTGTTCATCAGATGGCCATCTAATGAACGCCATGGAGCGCCC
ACAAACATGTGGGTGCACTACGAGCGAGTGCGATGGCATCGCGTGTGGTTCGGTCGTTAGTACGACTGCACATGGCCATGGAGTGGCTGATCGCCACACC
ATGAAGCCAATATTCCGGCGACTGCATTGAGGTGCAGGTCGCGCCGGAAGCCCACCACCCGAATAAGTCGAGTGGACTGCAGCATGGGTGTCCTCCGAAC
GGACAACACCCAAGTGAAAATGAACCGATTGCCAATGATTGGCAATACGATGATCTTAGTGCGATTGGAGAATCGCACGTAGGAGACCTGGTCGCGGTAG
CGCAACCACCGCCAGAGGATAACGAGGGAGCAATTCCACTCGTGTCAGATGACGAGATAGCCCAAGAGGCTAGTGAGGGAATAAGTCCCCACCCAGCTGT
GGAAATAAGTTCCCAGGAGACAATTGAGACATTAAATGTCCTAGTCAATGACGGATAAAGTATAGGGACATACCAACTTGATCTGATCGCGCCTCCGAAG
ACAACTTCGGAGATCATTCAATTGCCCACGCTCGAACAGAAGCGGTTCTTGTGTGATCTGCGTACTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGG
AAGATGAGTACGTAACCGATATTCGGTCGGCAATGGTATTCGCTGAGAACGAAAAGGTTCTCAGCAGCTCATCAATGGACGAGAGTGTCCTTGATGAGAA
GACTCGGATTGAGCGATACACATCCCAATCGTGGGAATCGCTCAAGACAAATCCTCTCTACGATGATTTGATGGAATTCAGGGATATATTCCCAGAAACA
ATGCCGTGCGAGCTACCCAAGGATAAGGGTACTCGTCACGAGATCGACCTGAAACCAGGTTCAAAGTAATGTGTCATGAAGCAATGGCCATTGCCTCGTG
AACAAGTACTAGCGATTGACAAATTCTTTGCCGATCGCTTGGCAGCGGACCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTGTCCG
GAAGGCCACAGGAGGATGGCGGTTGAATGCTGCCACTGTACCGGCTCAAACGCCGATACCAAGAAAAGATGTCATTATAGATGGTATATCAAGGATTACC
ATCTTTTCATCGATGGATCTGATGAAAGGGTTCTATCAGATCCTTATGCGCGAAAAGGACATTCCTTATACAACAGTGAGCACCCCAAGCGGTATGCTTT
GGGGTGGCTAGTAATGCCACAAGGGCTGAGTAATGCCACTGCTACGTTCAACAGATGTGTTACGAATCTGTTGAGATCTGTGCGAGAATTCGCACCCAGC
TATTTCGATGAAGTGTTCGTCCATAGCCGGGCTATGGATGGACAGACGGATGTGGAAGTCCACCGACTACACGTCCGGAAAGTTCTTACACTGATGCGTG
AGCACAAGTTGTATGCCAATCTCAAGAAGTGTATATTTGGTGCAAGCGAAATACCACTTCTTGGGTGCATCGTGGGTAAGCACGGCGTCCATCCCGATCC
GAAAAAGATCAAGGCGATCACTGACTGGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGTTCCTTGGCCTAGCGGCGTATCTACACAAATACTCGCAC
AATATCGCAGAGATGACTGTTCATCTCTCTCGTTTATTGAAAAAGAACGATAAGTGGGTATGGAGTGCTGATTGCCAGCGCTCTTTCGAAGGTAGCAAGC
AAATCTTGATACGCTCGCCAGTTTTGGCGATTGCAGACCAAGACAGACCATTTCATGTGGTCTGCGATGCAAGTGATTTTGCCATCAGATGTGAACTAAT
GCAGTACGACACAGACAGTGCTGAGCGTGTCGTCTGCTATCAGTCACGTCAGCGGCAACCAGCTGAACGTAACTACCCAGTCCATGACAAGGAACTCCTT
GCCATGAAGTATGCTTTGGCGAAGTTTAGGGTCTACCTACTAGGTGATAGACCCTTCATCGTATACAAGGACCATGCATCCTTACGCACGGCCGTTAACA
GTCCACACCTCTCGCAACGAATGGCGAGATGATTGTCGTTCTTCGCGGAGTATAACTTCTCCGTGGAATATAAGCCAGTACGATTGAATGTCGTTGCTGA
TGCTCTGTCGCGCCGGCCCGATTTCGAACCGGCTGCGCAACCCGACACTGTTCCGACCACTGTAGCGGTGTTGAAGTCGAGTGTCCCATCGTCAACCATA
TTAGAAGACATAAGCAAGGCGTACGATCCGGCGATGGTGTGTTTGATGGAACATCTCTCGCAACCATCCCGTCAATACCTTAAAAGGTTGCCCCCAGTAT
ATCGACCCTCCACGGATAGATATACAGTCCACAATGGCTTACTGACGTATACAGCCGTTGCCGGCGACACACCTCGTGTCGTCGTACCGGACCATGGTAA
TCTGCGACTGCGCATCATGTATAAGTACCACGATGCACCTACTGGTGGACATCGTGGTCGAGAGAAGACATATCTCACAGTTAGTCGCGACTTTTACTGT
CCCCGCCAGTATCAGTTTGTGCGAAAGTACGTCCGCGCATGCAAAGTATGTTAACGAGTAAATTCTGGTCCTTCACTTCGTGCGCCGTTGCAACCCTTGC
CCATTCCGGCAGAATGCTGGGAATCAGTCTCAATGGACTTTGTATTTGGAATTCCCGGAGACCCACACAAGAATACAGGTATTCTTGTGTTCGTTGATAG
ATTCAGTAAAATAGTACACCTGGTCGCTGTACCTGAATCCATCAATGCATCGGCATGTGCTCGTGTTTTTATTGACACGATCTTTCGTCTTCATGGGTTG
CCTCGTGAACTCCTCTCTGATCGAGACCCACGGTTTGCTGCGGAATTCTGGCGATCCGTGTTCAAAACACTCGGAACGCGCCTTCAGATGTCGACTTCTG
ACCATCCTGAAACAGATGGTCAGACAGAACGTGCAAACCGCGTTCTTGAGGAAATCTTTCGGGGTTATGTCCATTCGTTTACGAATTGGAGCGAATTCTT
GCCAATGGTGGAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCTTTCTTCGTGAATGGCTTGCGCTACCCACGCCTACCCACCTTC
TTATAGTGTAGCTCTAGTTTGAGGGGGAGAGGGAATCATTCGAGCGAGCGCCAACTCGGCTCTCACTCATCACGTACTGACCACGAGGTCACTACGTATG
ACGCCGATGTCGATCACATCGACTTCGGTGACGAAGAGGAAAGTAAGATTGAGGATGCTCTTACTACCCAGGTCACTGATCATGCCACAGTGCGCTCCAA
GAGCACTACAGCCAAATACAGCGTGTCAGCAGATGAATTCATACTGGCTCGCGAAACGGTTGTCCGTTTCGTGCGATATTCCATTGCAGAAGCAGTGGGC
CGACAAAAGAAAAACACAGACAAGAATGGAAGGGCAAATGTTCTTTCATTCAATGAAGGTGACCTAGTCCTACTATCTACGGTAAACTTACCTCGACACA
TAGTGACTAACGTGGGTAGCAACAAGTACTACCCAAGTTCATCGGTCCATTTTGTGTGCTGCGCCGCATAAGCAACGCATACACGATTCAACTGCCACGT
AAGATGCGCACGCATCCTACGTTCTACGTCGGTCGCCTTAGACCTTATCACCAGTGCGGGACTTCTTCCGGTGA