Description :
From Genome Similarity Track
Location :
contig_53:7041- 9080
Transcript NameFunction/comments
g10305.t1hypothetical protein

Sequence
2039 bases(100 bases per row)
CTCTTGATTTTGCATAAATCGATCATATATGCACTCTATGTGCACTGACAGCACGTAATCCTTTCTTAATTTACCAAAACCTGTTTTTACTCAAAACAAT
GCGGTGCTATTGCTGTTGTCTTTCTTGCCAAACATTATTTTGGCAATTGAAATGTTGGATGAACACACAACATATGCAAATATTTAGATTGAATCCAGAT
TTACGAGCGGCAATATGACAGTTGTCGGCTCTACGCCCATGTACGGCCTCTTATCTTCAGTTTTCACTGAAAAGGCCTTGTCCCAGCAAACCCCCATGCA
CGAGACAAAATCGAGGCATCGTAATATTGCAATTCAGAAACTCCATCGTGTGCTTGTCTAGCCAATGCTGTGCTCAGAGACGGAAGCATGGGGGTCAGAG
AAGCGCTTGTCTAGTTAAGTGGGGCGTATAACTGAAGGTTGGTCCTTGGTGAGATGGCGGCGACACAGGATGGTTGCAATTGACTCGCTCACTCAATGTA
GAATCTCGTTCTGTACTGGAGTGCCGTGGGTTTTCTTGTGACTGGATGTCTTGCGGCTCTTTTTGTTTCCGGCGGACCGTACAAGCGCTGGATGCAACAC
TCTTATCTCTCTTTCCTTATCGCAACCTCTCCAAGTCAATCAGTGCCAATGAAATTGTTTCAGAATCAATTGCTGCCGTCTCTTAGATTTATGATCACGA
TGAGCTCGTGTGCACATGGTCTTCCGTTTGTACGCCTGAAGTTTCCGGCACAAGGCGCAACAGGCAACCTCTTCCGAACAATTTTGTGAGCTTCACTCCA
CAGCACTGCCGTCTCTTGCAATGCGTATCTGCCCACAAACATTACTACAGCAGAGTAGCGCTCTTTTTTTAAGCAAGTGTGAATTTTTCGACACATCTTT
TTCGGATGCATGAGGATGTAAGATGCCCACCAAGGGAGTAGCTTCTTGAAGGCTTTGTTGGAACTTGGTCTTGAAATGGAGAAATGAAAAGTGATTGATT
GATAAAGACTAGTCCGTATGGTGCTCCTTGTTAGCCTTCTTTGTCGCCCAGCCGAGATGTGTCCTTGTATTGTCCTTCAGGGCGTGTCAGCTCTCCCGCC
GCTTGACCAGAAGTCGCCCATCCCTTATCCAGCTCGCTACCTTGAACTCGCGTCATATTTGTGAATCTTGGCACAGCTTGCGCCGTAAGCAGTAGCATCA
CTGATGATGCTACAACAGGCTTTGTCTTTGTACAGGTCGCCACGGGATCTCCACATCGCCGTCGGAGTCCACCGTGAAGCCGGGCATAGTTGAAGTTTAC
TTCAACCGCACTTAGGACGAACTTAACATATTCGTACTTAATATATGTAGATCGGTAGTCTTAGGGGACACAAGTGTCCGGGATAAACTTCGAAGAGCGC
AAAGCTAGCTTTGTCGCGAATACCCGGGGTCTTGTTCCAAAGAGGAAAGTTGATTGATTAATGAGCAAAGTTATTCAGGTAGAGGAAGTAAACTACGGCA
GACTACAACCTGTTCGCAGGTGTATCTCTAGTATGCTCCCGTTCATGTAGCATGGCGGACGCGTGCCGTCCACCACTAGAAGTTACTAGCCGCGCGCCTT
GACCGAGTAAACTCTCAGGAAGACCGTCCATGCTTCCTTCATAGGCAGCGAGGCACACTCAGTGAGCTGCTGTTCGATGGATCGGATGCTGGTGCTCCAC
AGCAGCCCGAGCTTGATCACAATCCGCCGACATAACTGGGGATATCCGGATGTCCCGGTTCCTGAAGCCGCACTACAGGAGGGATTGCTCGCTGGGGGGG
ATATCATGCTTAATGCAATTCGTGACGGTCTGTACAACGCATCCTAGAATTTGACGCTTCAACCATGGTATACGAAGCTAGGTAAAAGTTTGGTCATGAA
CTTCTTGTCTTTATCAGCAAATTGCGTTTTCTGGTCATCCACGATACGTCGTGTACTTGATTGAGCTTAAGCACCAATTCTCCCGAGTTCGTTCGTCTTC
GGGCTGGTAGAGTGTTGCGAAAGCAGCGCGGTGCAACTC