Description :
From Genome Similarity Track
Location :
Scaffold_2176:704- 3005
Sequence
2301 bases(100 bases per row)
ACTGTAGGGCCCTTCTCCCTGTCGGTAGTTTTGTGAGGACCCACGTTTTGTTGTCAATCAATGATTTGTATTCACAAATGGCTGCCTTCTCCCAGTGTTG
TGCTTCTGGTAGTTTCTGGGATTCTAGGAGCGTCTTTGGTTCAGATATGTGTCTGATAGCCAATAGAGCGTAGATATGAGTGAGGTGCTCTTTTCGTTCG
TTAATGTCGAGTGAATCATCAAGTAGACACGAGTGTTCATCCTCGTTCTGAGCGCTCGTTTTGTGTTTGACTTTCTTCATCTTTACTACTACTTCCGCGG
CAAGCGCATTGACGCTGCGTTTTAGTAGTGAGGCTATTGGAGGTAGCAATTGTGGTGTTGGTAGCGACGGTGATAGCGTCGGTGCGGGGCCATTTTGGTC
CGAGATTGCGGGTGTATTGAGGAATTCCAAGTGTGGGAACTCGTCTTCTCTAAACACAACATCCCTGCTGTAGATAACACGGTTTTCTTTCGTGTCAAGG
AGTCTATATCCCTTTTTGTTTGATGGGATTCCTAAGTATATGCTTTTCTTAGCACGTGGTTCTAGTTTTGTGCGGTGTATCTCAGGGATGTGAGCGTACG
CAGTACACCCAAACACTTTGATGTAGTGCGCGGATGGTTTTCGCTTGAACCATTTCTCGTATGGGGTGACCTTATCGGTTACCGAGCTGGGAGTAATGTT
CAGAAGGTCAGCAACGTGTTTGACGCATTCTCCCCAAAGAACCTGCGGTAGGTTACCATCAATGAGGAAAGCCCTGGTTCGTTCGAGTAGTGTACGCATG
CACCTCTCTGCAACTCCATTTTGCTGGGGCGTGTACGCATTTGTAAATTGTGCGTGCGTATTGTACTTCTAAAAAATCATTTTTCCAAGTTTATCATATT
CTCGGGCATTGTCGCTTTGAAGATGTTTAACTTCTTTATCGTGTATGTTCTCATTGAACTGGAGTTCGCCTACATCAGCGCGAAAAACGTTTTGTGCTTT
CTTGCGAAAATCTTCATAGCATTCGTACAGCTCAGACTTTCGCTTGATGATGTAGATGAACATGTACCGTGAGTAGTCATCTATAAAGGTAAAAAAACAT
TGACACCCCGAGAGTGTGGGGACGGGTAATGGACCAGCCATATCAGAATGAATTTTTTCAAGAGGGAACTTTGCCCGTTCAACGGTACGTTTATTGAATG
GGTTACGATGGGCCTTGGCGTATGTGCAGGAAGAGCAAAAGTAGTCTTTCTTGGAATCAAAGTCCTTCAGGCTCATGTCCATGACAGTGTTGGCTTTAGC
CAGATCCTGCATAATGCGAAAGTTAGGATGACCCATTCGTTTATGCCAAGTAACACATAATCAGGCTTACTGAAGTGGCCACATGGGCTACCTGACTGGA
GGTGGCCGGATCGCTGGAAAACGGGTAGAGTGGAGTTCCTTCCACCATTTTGGGTCTACAATTTGTGTTGTGGCTGAGGAGAGAAGAACAGAACGCACTT
CTTGGCGTTGGGGAAGTTGATTTTGAAATCATCTTCGACGGCTTGGCGCACGAAGAGTAGGTTGAACTTCAGCTGGGGCGCATATAGCACGTTTGCCAAG
GATATTTCTCGTTCCTTTCCCTTCGTGTCCTTGATTGTCATCTTGACATCACCAGTTCCTTTTATCGGAATCTGGTGATTGCCGCCGACAGTGATTGACT
TGCCAGCACTTGGGATCAGCTTCTCAAACCACTTCGGATTGGACGTAACGTGGCGAGTGCAGCCTGAGTCGACAGTCCACACTGGGTCATTCGCTATGCA
ACAAAAACATAGATGTCCACTCCCACCCTCATCAGATTCAAACTAACCAAACCAAACTCACGACCACCCCGCACATACCGTCACGACCTGTGCTACCACC
CATAGATACGGCGCATACCGCACGCCTTTATCAAATACTGACAACACTAAGAGAGAACATCCACACTCGCCGGCAGCACAATCTTTAATCGTCAAAGCAT
TCAGCGTCTTTCACCTCTGCATGTCTTCGGCTGGTGGCATGTTGGCCACCACCAACGTACGCTGCTTATGTTCTACCCGCCACGGATATCATCTCGTACA
TAATACTCTCAACAGGGGGGGGGCAACTTGCACGGTCAGACTCAGTGACATCATGCTAGCGGATCCGACAGTTGTTGCAGCTCGTAATGATATCTTCTTA
TATATTTTCACAGACATGATTCACACGCGACAGCAGTCTTCGGCACGACTTTACCTACGGCGTCGAGCAGCCGCAACACCAAGAATTCATCTGGAATATC
T