Description :
From Genome Similarity Track
Location :
scaffold_1105:704- 2202
Transcript NameFunction/comments
Pl_101307hypothetical protein PHYSODRAFT_533972

Sequence
1498 bases(100 bases per row)
CGTCGTATTCCGGACGTAGTACGGCTCCATTTGGTTCTCCACGGAACAGTAGGGGAAATTGGCAGTCTCAGTGTCCGGGTTGAAGAGGTTCTTGCCAGCG
TAGATCATGATGTAGCAGCCAACAGCGCTACAAATGACAATAACGAGGCTGGCCACGACACGTTCGTATACGGGCAGCTCATTCCAGAACACCTTGAGGT
AGAACACAATAGGCAGAGCGAGACAACACACTGTAATGGCTGAAGCACCCGTGAAATCCACAAGGTCGAGGAAGCGGTCACGGAGGCCGATGGAAGCCGC
CACGAGCGCTGCAATGATACAAAGACGGAGAGTCACGTAACGGAGCACGGTGCCAGTACCCTTGTACTCCGAGAGCTCTTGTTCTTCCTTCTCCTTCCGC
TGTTGCTCAGTATGCACCAAAACGCCTGGGGTGTTGGAAGCATTGTTTCACCTTCCGCTGTTGCTCAGTAGGCAACAAAACGCCTGGGGTGTTGGAAGCA
TTGTAGTTGTTCTCAATGTCCGGTGTCGTTAGCTCGACATTCGACATCTTGTTACTTTCTGGAGTGACGTTGTGCTTGTGCATGCCGAGGATGAAGCGTT
CGGCCAAGTAGAACGGCGGCTGGATAACCGTGGAGAAGGCAATGACGATGTGGACTTGCATGAACAGATATGCCATGACGACAGCGCCACGGTTGGCGGT
GAAACCCAAAGCCGATGCAGCCGTCGGGTCTGCTACATTCACGATGGAGAACAACAGATTGCCCGAGAGTTGGCAACCACCAGCAGCGTAGCCGGCAATG
GCGATGGCAAGGAAGAAGGCCGAACCAGCACCAAGACTGACGAGGATAATACGGGGCATACGGGTGGGATCTGAGTGTTGACGTTGAAGGTCCGGCACGA
CAACGGAAGCGCCGTACGCCAACGACAAATTACCGAACGTAGTGAGCACCTGGTGCAGCGTGATGTCCGGCGTCGGGATCGACGGGTGATCTCGCATCTC
CCACTCGAGAATGCTAACCCCGATAACATCAGTGATGAGCGTGCCGAGGCAACCGACAAACGCCACAGAGGCGGCTTCCTTCAACGTCGGGATCAAGCAG
GACGGCACCACGGTGATCGCCATGAAGACGATCCAGAAGATCTGGCTGAACGAATCCGGGAACAGCACGTCAAGCAGTGTACTACCAAGGACCAGGAAGG
CACAAGGCAACAGCAAGCAGACAAGCAGTTGGGACACAATGACGAGATAGCGTCCAGTCTTGCCGAACACCCAATCACCGACGTCTGTGAAAGTCTTGAC
CGAAGCGGGCGCCACCAGCATCACCTTGGAGAGCGCGATCGTGGCGTAAATATTGGCAAACGCCATCAGCATCATTGCGATGGTGGCGTATACGGGTCCA
GCACGAGCAAAATTGGACGGCATGGACAGCGTGCCAATGCCGAAGAAGCAGCACACGATGTTGAAGATGGTACTGGCATCTTCCAGCGTCAAGAAGGC