Description :
From Genome Similarity Track
Location :
Scaffold_61:7038- 8592
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16943hypothetical protein

Sequence
1554 bases(100 bases per row)
ACTAACAGCATACTTACTCTAGTTTAGTGCTTTTCTAGCTCACATTGAGCTGAGCATTAAGCTCCAAATGGCCACCCTCGCGCGAAATGGGTACCCACAA
TACCAACGAACCACCGCCCGTGCCAGGGAGACCGAGAAACCCCGGACGCCAACGATCTAGGTACAGAGTCTTGCCACCAAGTGCAGTAATATTTGATCTC
CATTGTGCAGAGCCGCCAGCTTTAAGGTCGACTTCGTCGATCTTGTCACCACCGGACATGATATTAACGGTCACATCCTTCGTGTCCTTACTCTTGAAGT
TAATAACAACAGCACCGTCGCCCTTCTTGGTCCAAGTCAGCGTACTGTTCTTGAAAGCCTTGTGAAGCGCGCTCATACCCAGAGTGGCTGCTTCATCCCC
GTCGTCAATTTCACCCATGAACTGGGTAGGGCCACAAATGGTCTGGAGGTATTCTGCAAACAGGGTCGATAAATCCGTCGGGTCCCAACCGAATGATGCA
AAGGTCAGAGCATTGTCGATCCATACATAAGCGCTGTGCTTTGTGGCCATGGATGTGCCATTGTCGCTCTTGCCAGACTTGATGAGATCGTCGATCATCA
CTGCATAGGTCTTGCGAAGTGTGTCGCGTGTCTTGTACGCTGTGGCCACCGTAGACTCGGAGATCATTTTGGTCATACAGTTGTTGGTTACCGCCGGGAT
GTCGTATAATATAAGATCAGACTCGCTTAACTTCAAGCGGAGTTCAGCTTCGCTGATCTTAGGATTCTTCTGCCTGTACTCGTCCACCGTCATCCAGACC
TGGTTGGTCAACGTCTTGAGGTCGTCTCCGCATGTGGAGTTCTGCTTCATAGCTGTTTCCAAGCTTGAGATCTCTTCCTCCGTAATTTGTTCTGCGGCTT
CCGTAAAGTTGGCCCTTTTCATGAAAGCCTTAAATTTTTCCCAACTTTTAATAATGTCGTCGTCATAGCTGAGCACCAACAAAAGGAGGAACTGAGCAGT
GGGCAGTATCTGGCGTGTTAATGTGATACTTGCCGGCACAGTCTTGCCTGAGCACGCATAGATGGTACCAGGAAGATCAGCGACGACGTAATTGGTCTGG
TATAGTAGCAATAGTAGTTTCTCCTGCGAAGTCTCCGGTTCGTTGATCATTTGGTTACGCGTGAAACGCACGACAGCTCTCGTGAAAGTCATGAGATAAT
TGGCACATCGAGCGGCCCAGGTCACGTGTTTTCCATACTTTGCCAATTGACCGAACACACCAAAGGTGGCCATACTCAGGGCGGACATGGCAACGGCAGA
AATCTTGGCAACGTTCTCACGACCGCAGTCATTGTTCTGTTGGATGCACTGCATGCCACATTCCACGGGATAATCCATCGGACACTCCGTCCAGCACGTG
TTGGTTAATTCATTACGGTCATAGTTGCTCGGACACTTTTTCATGAAGTGAGCTTCGCGATAGCAAGCCGAGTCCGAGGACTGAGTCCAAGGTCCCACCC
AGTTGCGGTAGGTCGATTTAAAGTTGGTAACGGCAGTCGAAGGAGTCGCGATCT