Description :
From Genome Similarity Track
Location :
scaffold_86:70356- 72212
Transcript NameFunction/comments
g3149.t1 hypothetical protein PHYSODRAFT_469031
g3150.t1 serine hydrolase (FSH1)-like protein, putative

Sequence
1856 bases(100 bases per row)
CTTCCCCGCCCAAGAAGCTCCGTGTGTTGTGTCTCCACGGCTTCCGCACAAACCGCCAAGTGATGGAGAGTCAAACCCAGGGACTGCGAGAGGCTTTAGG
CCCCAACACCGAGTTCGTCTTTCTTAACGGACCGTTCGAAGCTCGCGGACCGACTGACAAGATCATTGAGCGCATTTTCGGCCGCACAGCCCCGTTCTAT
GAATGGTGGGGTGCACGATCTTTAGAGAAGGAAGAACGCGATGACGTTGAGGCCGAAGACGGAGTTCCAAGGGGCGCCACTAAGCGTTGGTGCCTCGAAT
TCGATGATATCGACCAGGCCATTGAGTACATGGATGAAAAGCTAAACGAACTGGGCGAGTTCGACCTGGCCGTGGGCTTTTCGCAGGGCTCCATTATGCT
CACGATCCTGACAATGTGGTACCTCAAGAAAGCGAACAAGTGCTGGTGGAAGCTTGTGCTCTGCGTTTGTGGCGTGTACCCACAAGGCATTAATGTCCGG
GAGCTCTTTGAAACGCATGAAGGACAGCCGATTATGGTGCCTGTACCATCGATCCACGTCGTGGGGAAGAAAGATAGTCTCTATAAAGACTCACTGGTGC
TCAAGGACATGTATACGGAGCACCCTAAGGGCAGTCCCTTGTCAAGAGTCTTGCTAGAGCACGACGGTGGACACAAATTTCCTACACCAAAGCGACACAA
GCAGTTCTACGCCGACTTGGCCAACATGATTTGGCGGTTTTTCGAAGATACGCGCCAGAGCTCTTCGGCTAGACTTTAGTAGAGAACGACAACCACCATA
ATACATTTGACGTACAATCTCAATGTTAAACGAGCTCATGCTTCAGTTTTCTCGAGGATCTTGAACGGATGACGATGCTTTATCCTCACACTCTCTCCGA
TTTGTGTGTACGTCATCGTGCTTGAAGTTGAAGAGACCCGAAGTCTCTGCTCACTCGACATTTTGCAGCGCATCTGACACTCTCAACTGACCACCATGGT
GATCGTTGCTGAGAATTTACCTCAACCTACGGCGTTATCCCCTCCTCCGTTTGAGTCCTCCAAGAAGATCCGTGTGCTGTGTTTGCATGGGTTTCGCACC
AACAAGGAGGTCATGCTGGATCAGACTCGAGGCCTTCGAGCGGTGCTGGGGGATTCTGCTGAATTCGTGATACTGAACGGCACGTACGAAGCTCGCGGGA
CGAGTGATCCAATGATCGAGAGTGCGTACAAGTCCAGTGCCCCGTTCTACGAGTGGTTCGAGAATCAGCTGGCTGACGGATCTCCGCTACTGTACAACGA
CGCCGAATCGTCCGCCAAGGCGCGTCTTCTAAGTGGCGCCGACAAAGGAGAAGACCACGCGTGGAGTTTGTCCTACAAGGGCGTCGAGCAGTCGATGATA
AGGATCGACGAGGAACTTCGTCGTCATGGCCCGTTCGACGTTGTCATTGGGTTTTCCCAGGGTGCAGCGCTGCTGACAATCCTGACGATGTGGTACCTGC
GCCACGGGAACGTGCGTTGGTGGAAGCTGGTGATCTGCGTTGGTGGTGTGGATGTGAGTGGTGTCAATGTCAAGTCGCTGTTTCTGGATAAATCGGGCAA
CCGCATTCTCGTGCCTCTGCCTTCGATCCACCTTATTGGCAAGACGGACCCGCTCTACCATGAGTCGCATCGCTTGGCATTGTCGTGGACAGACAAAGCG
GAACCGAATGATTTCAAGAAGCGGATCTACGTGCATGGCGGCGGGCACAAATTCCCTTCCGTTTCGAAGAACCGTGGGTTCTACGCGGAGTTGGGCCAAG
TCATCAAACAACACTGCAACAAAGATTTGGAAACATCGACAGCTAGACTGTAAGTG