Description :
From Genome Similarity Track
Location :
Scaffold_264:7035- 10211
Transcript NameFunction/comments
Hyaar_Emoy2813327hypothetical protein

Sequence
3176 bases(100 bases per row)
TCATTGTTTCTAATGTTATAATTGGTACTATTGTTAGTTTGCTTTCAGTTGCTCATGTCGTTGTTACTGCTACCGCTGTAGCCGTTGTCGCTGTAAACAT
TTTTGATGTTCCTGTTGCTTTTGTTACTTCTGCTGTTGCTGCTACTGGTGGTGCTGCTGCTGATGCCATTGTTCTTGTTCTTGTCGTTGCTACTGTTGCT
GTTGTTGGTACTGGTGTAGCTGTTAATTTTGCTGCTTCTGTTCCTTTGCTACTGCTGCTCTTGCTACTGCTGTTAGTGTTAGTGGTGTTAGTATTGTTTT
GTGGTGGTTTTGGTGCTACAGTGGTGCTTTTATAGTTGGTTTTGTTGTGGGATAGACATTCACTTCCCGCTCGTATCCTATAGCAACTCAGCGCATATGT
AACTATTAAATAGACTATCATGAACCTATTCTACCTGTTGACTCTCATTTTACTAATTTGAAGGCTTTACCAAGGCTGATGGCGACACTTCAGTGCTGTT
GCAGGGATTAGTTGGTGATGTTAATGATTTTAGACTTAATGGACAGCACGCTGGACGTGGAGAGTTCAAGATGTAATGAAAGTCAGACGTATCAGCACAT
TGCGGGTGAATGGTGATTATAATAGGTAAATTTCTTAATCAAAGCATCACGTCAGTATGTGTTTACCACGTTAACTTGAGTATACAAAGACGTGAGGCAT
TTTCCCTACAACAATACGCCTATCAGTTTCAGATCTCTTTATGTGTGTATCACACCAGCGTGCGTGGTAATGACATCGTTTGTGTAACCCCGATATAGCA
CTTCTTTAAGCAACTTCTTGATAACGTGTACCCATCATTATCGTATACGTATCTATCACCGTTTTCGTGCCCGCCGGCAGCGCCTGAACATCCTCTGCAG
ACGGCACTAGCGAATGACATTTACGTGTTTAGATGCTTTGACATCACAATTTTCTGACCATCATCTTCTTTTGAAGCGCATGGTTGCTTTATATTAGAAT
GTGAAAACTTTGTTTCTCTGCACCTATGTAGCGGAGCTACCCTTACTCCTTTGTCAGAGGAAGACTTCTGGACTCGTAGAGTCTCTTAGTATATTAAACT
AAACGGGTATTAACTTAAAGGGTCCCAAGTCTTACAGACTTAGTGAGACTTAAGTCTAAGTGTAATGTACAAGCTCTTAAGCTTCTAGTCCTGGTTCAGG
GGAATATGACTCCAAGGAATCACGTGGCACTAATGCCAAGAGTACTTAGCTTAACTTAGGCACTTAACTCTTACGACCAGAGACGTCTTAGAAAGACACG
TGTCTAAAACTGATCAAAAGGGGAACTGAATATATTTACTGAATTATAGTGATAATAAACCTTACTTACGTCTTTAACCTTGAAACTATGCTACCTAATC
GAATAGTCCTCATCGTAGTTCTTCTTGTGTACCACACCAGAACTACGTCGCCTCTATGAAAACCCTATTACGATAGATATCCTCTAACCATAACTGATAG
GGTACGGTATTATCGCTTAGCGTATGTGATACAAAAGTATGTCTTATCAGTGATACTGATCTGTTTCTGTGTGTACCACACCAATGTACCTGGTTATCTC
AATCATTTGTGTATCCCCGTTACACCCTCCCCCACCAAACAGTCGATACCCCGAATCGACATTCTTCACCTTTCTCGTTGAGATAGCTCGTTGAAAACAG
ATAACCTCACGGTTGTGTTCACGACACCTTGCACATCAATGGCGAAGTGTTCGCATTCCTCCGAGTCTTTGGAAGACTTCATACGAGAAGAGAACATTGT
TGATTATGACAGTGACACTGTCCTGGAAGAGGGTGAAACCCCGAACCTGCCACGTCAGCGTCGTGCGAGCCTTCTCGCATAGCGCCAAACCCATTTCCGG
AACGAAGCACGGCTCAAACTCTAACAGCGTAGCGTGCCTCAACTACTCTTGATGAACCTATCATCACCAACAAGCTCGATGAGCAACAGCAACGCTATAT
CGAGGAGAATGAGAGAGAGAGATGTCTATCTCGGACATTAGCTATCTCCGAAGCGTATTCGGACTATCGCTTCAAGACTTCGAGCGTTGATGAGTTGTTG
CGAAAGTTCGCAGGGCAGCCCTTGACTACTTGGCCCACAGGGCGCGAGGCTAGGACGCCCGACGACATTGCCGAACGAGATGCTCTCAGCGGGAAATACT
TGACGCCCGAAATGACGACGATCTCCGATTATCAAATCAAATTGACAGAACAAGCACGTGGTTCCTCTGTACCGACGCAGAGAACGGTCCCGGTCGTTCT
GTACCCATTTGAGAGCAAGGCCGAGGATGACAGCACGTTCACTCGTTGGGCACATACGGCACGTCGATTTTCCAGCATGAGTGCCCTTCCATCTAGTGCC
TCCAGGGCCGACGTTCGGCAAGAGCGCAAGCTGCGCTATGAGTTTGCTAAGCTAAAGGCCAAAGGCCAGCTACGTTCGCTGTATCGCACGCAGTACGCAA
AAACAGTTGCTGGTCCAACCACCACTGTTTCGACTGTGCAGAAAGTCGCGGGTCACTCGGTGTTAATCGGCGAGCCCTTCACCCCCACACCTATTGGTGG
GAAGCGCGTTGGGGTGCAAGCTGACCATCAGCGCGACGCTCAAAAACGTCAACGGCATACGGGCAGTCTTGCCGAAGGGGTACCTCAAACTCCCATGAAT
TTTCAGACTCAGGGTATCCACGCCACTTCACCAGATACTGGTATTGACGTTTACGACAACGCCGCTTCAGAAGTCTCTCCACATGGAACTGTAAGTTCCC
TTGCTCGTCGAGCAACGCAGGAGGGGGTCGGTGTGTCGGCACAGGCTCATAAAGACTTGGTGTCAGAGGTGAAGCGACTCCGAGAGTCTTTTGCTCACGT
GCTGACGGCACTGGATCAGTCTGTGACTAAGAAGAAACAACTCCGGGAGATCCTTGACCAATTGCAACACGCTCGTGAACAGTCATCGACTGAGTTGGCC
CAGTTGCGTGAGCAGATGAAACGTCTCGGTTCGATCTACTCGGTCGCCAAGCGACTGCGGAAGGTGGAGTACAACCTGCCACGGCTGAATGGCCAGGTGG
AGCTCTTGACGAAAATACAGTTATCGGGGACGACGTCCCTCTTCAGGCGCAAGCGCCTTCCGGTCCACGAAGTAAG