Description :
From Genome Similarity Track
Location :
Scaffold_168:70342- 71354
Sequence
1012 bases(100 bases per row)
GACGAGGCGCTGCAGTTGCGGCTGCGACCGAGCGTTTGAACCAGCACATCGCTGCAGAAAGCCATCTAAGCGATCTCGCCGGCGCTGCAACCAACAAAAG
CGATGGCACAGCTACGTCGACTGCGCGAACTCTTTGACGCCCAGGAACGCGTGTTCACGACAGTTCCAGGGCTTGCAGACTACGTAACGCAACTGGAACC
ATCTCGTGGTAGTACTTGCGCTATACGTATGTGTTTCCTCCGTGACAGCCACTTCACAACAGGTGAGTTTCCTTCCTTGCCTTCGGCTTGCCAACGCTGC
ATACTAACAATACCGTCACCCTCCAAATGGCCAGATCAATACAGCGGAACGCATCTCGAATTCATCGATGCCGAATCGGCTAGCGTGTTTGACAACGCGC
GCTCCATGTTGCTGGCGATCCCGCTAAATCAAGCCAGAAGCGAGATATGCAGGCTGACAGTGTGGGAGCGGACAGACCTCACTAACTTTACACTAGGTAC
ACTACACTACTTTGTGTCTACCTTATCCAAACTAACAGCTCTATTGCAACAATCTGCAGGTGTTGTGTATGAAATCCGGCACGTCTTCAACCTAAATCTC
TACACCAAGATGCCACAAGGATCCGCAATGAGAGTCTGTGCCGAAGGACGGCTCGAAGTGAAGCAACCCAACGTAGCCAACGACGCAACGCCGGCCAGCA
ACGCAGGTACTCCTACTGCTGCTCCCGCGTCAACTAGCGCAAGCGATGCTGCACAACTCGACGTTCACACTAAAACCACAGACGCAGTTGACCTCGCCGT
GTCCGCAACACCCAAACGCAAGCATCCTGATGGACCGCAGAAGGCGCCGCCCAAGCCACCATCCCAGAAGAAACACCGCGCCGTCCAGTAAGTCAGCTAC
GACTGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCACACATTCAGGTGACCACCACAGGGTGGTCCACATTCATA
GCAAAAGGCATA