Description :
From Genome Similarity Track
Location :
contig_4:70340- 74678
Transcript NameFunction/comments
g1287.t1hypothetical protein

Sequence
4338 bases(100 bases per row)
AGGCCGCGAGCTGCGCTCTGCTTTGCAGGCATAGGCACTCACCATCCTTGCCGCAGCGCAAGATGACGAGTATCCAAGGCAACACACCTCTCAAAGCGCC
TATTTCGCTGCACGAGCTTAACTTTCGGCTGGCTCGGTTTCCGAACTGCCGAAACGCATGCCGGCGCTTCCGGCCCCATCTCCAGTCCGCCCCGGTGATT
CGCCCATTTCCCGTCCAATAGTGTGTATCCATTGGTCAAAAGTCTGTTTTATCAACGGGAGGGGGCCGTTGCGGTCATTTCCACCGAAGCCTCCCATCGA
GAAGCTAGCGCTGCGTGTGTGCGTGCCTCGAAGCGCTTAGCGGCAGTCCGCGAGACAGACAGACGGACGCAGGGCCCGACAGGCATGCTGCGCTTCTAGA
CCGGCGCCTTCCTTTCTCTCGTCTCCGCCTCCCAAGAAGCAAGAGAGGAAAGAGCCCTATAGTCCCTATTGTCTCCCTGCTGGATGGCAGACATCGCCAT
GACTGGAGAAGCCGGCGCCAACCGCACGTTCCGCTCCATCTTCGGCGACCAGGAGCAGCGGCACGACGAGGTGCATAAGCTGGAGCTGGGGCAGAGCGTC
AGCAGCAGACCCGTCGTCACCGACTCGGGTGCTGGACTGGCCATGGACGACGACGACGAAGCCATGTGGAGTGACGAGCCGCCGCTGGGCGATGCAATAG
CTCAGGATAACAACGACCTGCCGGGGCTCCAGTTCGCGGTGCGTTGTTGGTTGTTGCGAAACGGCTAGGGAGTGCCAACCTTTGAATTGACTTTTGGTGT
TTTTGCTTGCGATTCTCAGCAACGCAAGTCCATGGAAGAGTGGGCAGAGGATGATGACGAAGAGGAAAACTGGAAGGATGCACTGCAAGACCGCGTCAAC
CAGCTGGAGCTTGCGTTCCAACACAACAATGACACCGCTGCAGCAGACTCCCGGCGTCGCTTCGAGCAGCAGCAACTGCTGCAGTTTTCAGCGCCTGAGA
CGCATCACATCAACTTTGGCCAGACTCTCCCGGTCTCAGCGCGCTTCACCACGACGAACTTGGGCTCGGAGCGCTTGCGACCAGCTAGTCGCCATAAGAT
GCAGCGCACATCCTCGTCGCATGCATGCATCACTGGCGAGGCTGCCGTTCAAACTGCGTCTGGACGCTCAAACCACCTCTGGAATTTCCAACGCAAGGTA
GCGGGAGGGACCACACCGACTCCGATCGCTCAAGATGCACGCAAGCGGTCAACCTCCATAGATTTCGTGGCCCGCAACATTCAGACAGTCGAGCACCATC
GCAAGCGCTCCGGTTCTTTGAGTGGGGCATCCAGCAGGACCGATTCGCCTCGACATTCTCAGTCCCGGAAGAATTCCTTGGACAGTAATCACAGCAGCCT
CGGCCGAAGTAATAGTAGTAGTCTCCACGGGAACACGGCAGCTGCACCAGCCGACAGCACATCATCAGGCGCGGCGGTATTTAACCTGAGCGACACGGAA
GCCATTCGCCGTTTTGTGCTCGACGACGTCAAAACGGTAAGTCACCCCTCTCTGTCTTGGAACGCTTGAGGCTGCGCTCTGACATTGTGCTCTGCTGTGA
ATAATGCAGATGTCCATGGAGCGACTGGTAGGCGACGCCCAGCGCTTACATTTTTTAGAGGATTTCTACCAGAATCACCACGCACCAGGCCCCGGGCCGG
CCGCCGCGGCGCCACCGTCGCCTTCCCCCTCCTCAGCTATGTCCACGTCCTGACCGCACTCTGTTCTATTACATTCCTTTGCCTTGCCTTGCTGTTCGGA
TGCGATATTTTGCTGCATGCTCTATTTAACGACATTTTAATCTTTGCTGCAACGCACGCCATGTGCGTCTTCATCTCGTTTCTTGGTTTGTGTTATGCTT
CATTCCTCTGCGCAGCATCTAACTACGCTACGTGCAGGCTGCACTGCAGCCTTGGGCTTGGTCACGCCACCTGGGCGCTGACTGAAATCGAAGGAAGCAG
CGACCTCAATCGCCCGTACGATTTGGATGCAGCAAGAATCCTTCTCTATACACGGGCAGCGAGGTGTATTCACCTCCAATCTTTCGATCACAAAGCCGAT
TGATTCATCTACGACAGCTCGGAGGTGACCTCCGCCATCAACCTCCGATACACCGGCCCCTCCTTCTAGTTGGAGGTATGGGTAATGCTGACATCTTAGC
TTCGCGTTCTTTTTGACGGACGTGGAGATCACTAACGCGTAACATGCTGACCTGTGTATTGCTTCCCAGGCTCGAATGCTCCTCGAAGGCGCTCTCGCTG
TAGAGAAGACAATCAGATTTGCGTCGGCTTGAGAATTACTGCGATGATGTGGAGAGTGGCCAGTTCTCATACGAGAATACTCTCTGTGTAACCACGATAT
GCATGAAATGTAATGTGACTAGAGCTGTCGTGGTTAACTAACCTCACCTCTAATCGACCCACACCTCTACCTCTGGCCTAACCTCTATATCTGTGGCCCA
CACATTATTATCATACAAAACCCAAGTATAAACTAGTGTTGGCGAACACAAAGAACCCCGTCCGCAACGACATTGGCGAGATCAAGCTACTGGAGGCTAA
GAGCAAGGAGGATGTCAAGCAAACCAACGAGCTGCCCAAGGGGATGAAGGCGCTGTAGCACAGCGACAAAATGATGGCGCAGTCGATGGCCTTGAGCGGC
TGCAGCGAGACCAACTACCGTACCGTACAATCTCCAGACGTGCCAGAGGAAGTTCCTCCACGACATGCATATCTTCATGCAGCTCTGCTCCAAGGTACAG
GGGAACTGTCGTACCGACGAGAGCGACGAGTTTGGAAATGCGCAGTGAAGAGACATTCAACTTCGTTGCGGCGGCACTTTAGTAACGCGTATTGACTTGA
CCAAGTATTTCTCCACTATGGCTAAGTCATCGTCTTCCTACATCTTCCTATCGTGAATCAACACACTCACACCGCCGTAATCGATCAAGGAACCCCATGC
ATGCCTTGCCTATCGGGTGAGAGCTCACCTGTTTCGGTTGCCTTCGTCATGCATCCCTGTGAGTTGAGGTCATCCGTGAATATGAATTCGAACGCAGTGC
TTGTTCGAAGCAGATCCTCTTGCTCGACATCGGCACGACTTGCTTGCTATCAAGGCGGTATTGATGCCAATAAGGACCGAAGACATGTAGGGCACAAGTG
TTGTGAAAATGACTCATGTGGTCCGTTTCCGAATCACGAAAGCAATCGTCATATTACACCGCTTTCAATACACGTAGAGTGGCCGTTGTCAAACTCTTCG
TCGGAGATACCAGTAGTTCGGATGAGGAAACATTTGAACAAATAACCACAGTTGATACTTGTGCTGGCGTCGTGCCGTAAATAACCGCGTGGATCACTAT
GAAGCCGTGTCCCGGGCTTAGGAATGCTCCAGAAGCGTACAGCTAGGTCTAATTTTGGATCGCGTTTGGGTGCGGCTGCAACCTCCGGAAGAGTGGCTGT
GGGTCTACTGCTTGATGAGCTGGCAATGACGACATCACTTGCACCTGTTACTGTTTCTTTAGCTGACAAGGTGAAGAACAGGACTGAGGATGCCGCTGTC
GTGTAGGAACACGTCCAAAATATGTATGCACACTCCCACCACCAACACCCACCAAATCCACGAGGATTCAATGAGCTTTGTCGGGCAAATAGAACCCGGA
GGCCCTAGTTCTCGCCCTTACACCGGGTTGGATGTTTCCTCTGCGTACTGTGGTTTCCGTAGGCTACTAACCAATATCCAGCACCACTAGCCACGAGCGA
CGGCTAGGATGCTCTTCTCACACTGAAACCTCGTTGTCCCTCAGAAAGGAAGGGTACGAGCCGGTCAAGGCCTTGTACGAGGTGCCGGGGCTTAACTCCG
GTGGGAAGAATATATGGGACGCACTCAGGCGTTCCCAAGTGCCAACGAGTTCTCGTTGGTCTTCTATCACACGCACGGCCACTCTCTCTCTTTTTTCTTG
GCCTACCAGATAAACACTAGCCCACACAAACTACGTGTTCACCAACATACAGTTCCTACCCTACCGAGCGGGACCAGACGCTCCGGACACTTACCGAAGC
CGGACTTGACTCTTGAGTGGTTGAGAGGAAAAGATGTTCTGTTTGTTGTTGCCCAGTGGCCATTCCTAATGCTATGCTTTCCTATGGTTCCTATACAAAT
ACCTAGTGTAAACGAGTCCGTTACGGATCTTCTCAGTAACCTACGAGGACTCCACCGTCGCCGACGCTTCGGAACAGCCGAACGACGACTCGGACTGGTC
ATCGGTTTTGGACCTTGCCTCTAAATACGCTCTGCGCC