Description :
From Genome Similarity Track
Location :
Scaffold_889:7034- 8477
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_889-fgenesh-gene-0.1Haustorium-specific membrane protein

Sequence
1443 bases(100 bases per row)
AACgTTCAGTTGCGCCGTGAGCTCCAAGTGTCCTCCAGTAGACGATCGcGGCACCCACGCCAAGAGCGAACCGCCACCAGTTCCCGagAGGCCCAGAAAG
CCAGGACGCCAGCGGTCCAAGTACAGCGTTTTGTCCTGAAGATCCGCGATAGGCTTGgCCCATTCGGCGCGTTGACCCTTCGCGACAGGCACAGTCCCGA
TCTGGGAgCCTCCAGACCATACGTTCActGTGACATCTTGAGTATCCTTGCTCTCGAAAACGATCTTGACTTGACCATCGCCAGATTTGGTCCAGTGTCC
GTAACTTCCGTTGAACGCGTTGTCGACAGTGCGGAGTCCAAGAGCAAGAGCAGCAGGACCAtcATCAATCTCGCCAATCATTGATGTTGGACCgCAAATT
GGCTGCAAGAACTCAGCGACCATCTTCACGATCCCAGTCGAGTCCAAGCCTGAGAGAGCATCGAGACCGAGGTTTGCCGCTACCATGATGTACGTTTCAA
CTGGAACTGGGTTACCATTCTGATACGCCGCGTCAATCACTTTGTCAaTGAAGCCCTGAAGCGCGTTACGGATGGTATCACGAATgTCGAAGGCATTCGg
CGCAGACGACGtaGCCGAGGAGCCACAGTGCGACGTCAGTGCTGGGAGTTCCTTCAAGAAAAGCGACGTCTTGGTGAGCTCAATGCGGATCTGTTCtGGG
gTGATCTTGCTGTTCTGCTTCTTCAGCTCAACGATGTGAGCGACGATGCGATCGAGAACGTTCTTGAGCTGCATGCCACATGCTGgaCCGTTGGCGATAA
GCTCCTTGAATTTaGCCAAGTCGGACGAACtAAGTGCCGAGATTGAGGAACCCAGGttcACGTCCTTGGTCAGCTGGATGAACGCATTcGGAGCAAGAAC
GGCCGACCCGTTAGCAGCAATCCTCTCAACAATCAACTTCACGATTGCGCTGACGGCACTgCCAACAGCAGTAGGTGCACCAGCACACTTGACGACCGCG
GCGgTGAGCTCGGAAGTGACGACTTCGgACTTCAGCAACTCCAGAACGATTTTCTCGGTTGGAAGATCGGGTGTGGCCTTCTGGATAGTACCGACAAGCT
GtACGATCTTGTTGACGACGGTGAATAAGTCACCACCGCATTTGAGCCCAGCtGACACGTTACTGCTGATGAGGCTCGAGAACATGCTGCTGGAAGCGAG
GTTGATAGCAACGTTGGCGACGGCGCCGATTTTAGTGATCACTTCAAGAGTGCAATCCTTGCTTTGTGGGATACACTCCATGCCACATaCGACCGGATAC
TCAAGTGGACACTGTGCCCAGCAGCCTCCGAGCTTGTCACTGTCGTAGCCGAGTGGACACTGGTTGCTaCGTTGCGTCTTGCGGTAGCATGCCGTATCAA
TGGGGCgCCCAATCTTCGGGCCGACCCAATTCGGCAGTGCtgA