Description :
From Genome Similarity Track
Location :
Scaffold_367:7031- 10194
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_367-fgenesh-gene-0.14Lariat debranching enzyme B
Pytul_var.sporangiiferummaker-pug3_contig_367-fgenesh-gene-0.5Conserved gene of unknown function

Sequence
3163 bases(100 bases per row)
CTCCAGCTGCTCATCCTCGTCTTCGTCGTCGTCTAAGTCTATTGCGTTCGGATCGTCCACGACCACAGCACCCACGGCATCCCCTGCACCGCCGCCAACG
TACGGCGCCGTGACAACGTGAGGCAACTTGAGCAGCTCGAGCAGCAAATCGGTCTGTGGATTGCCATTGAACCCTTTCCCATCCCACGACTGCTCCTCTT
CGCCGAATGCTGGCGCCGTCTTGACAAAGTCGGTGATCCACTCGCCCTCGACCTTGTTGAGGCCTTTTTCCGTGACGACTTCACACAGTCGCTCTCTCAC
CCACGCGATGTCCTGATCTTCGATACGCATCTCTTCTTGAGGAACGCGAGGCGCATACTTGCTCGTCGAGGCCAAGTGGTGCGTCGCGCGAAGCACTGCG
AGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACGGCTCTCTCGCGGTGGGTTTGTCAGTGTTGTCGGCACCCTCACTTG
ATTCTGCTTGATTCGCATCAGCGGTTGGAGGTCCAATGTCGAGCACTTGCAGGAACTCTCTCCGTGGAAGACACTTGTCGAGGGCAAGAAATTTCGTCAT
TTCTTCAACTGGTGGTATCGGAGTGGCAGCTTCACTTGCCTCGTTCACATCGTGTTCCCCTGTTGCCGCTTCTGTGATCTCCGTTGGTGGTAATGGTGGT
GGAGCTGGCGCAGCCGCGTGACGTACAAGCGCGGCGAACTTGACGTGAAGGTGCGCCGCGAACCAATGCTGTGGTTTCAACTGGAACAACAGGAACTCAC
CAGCCGGACTTCCTAGGCTGTTTGACTGAATCTCCTGCTGAAAGAACGGCTTGCGTCGAATCAGCGCGCGCACATCGCCGTATTGTTCAATGCCGCGTGG
CCAGTCATGCGACAGAAACACGTTCACTTTCTTCGGATCCTGCATCTGCAGATGTGACAACTGAAATACCTCCAGCTNNNNNNNNNNNNNNNNNNNNNNN
NNNGTACTGTTATCAAACGGCGCCTTCTCGAATCGTCCGGACGTGTAGTCCTGCTGCTTGTAGATGCCCGAGAGGCCGCCAATGCGCAAGCCGCCAACGT
TCACGACNNNNNNNNNNNNNNNCGCTGCACCCAAGTAAAAGATGTTTGGCGCGACCCAGCCGCCATAATGCAACTCCGACAGATAGTTGGAAGCCTCGTG
GTTGCCACCGATGAAGATCGTGAGTACGGGTGCCACTTTCTCGCCCTTGTAGAACTGGTGGAACGAGTGCATCTCGCGATACTTGGGTGGACACGCGAGG
TTTTCCAGGTCGCGCGAGTTGCGCATGCACTCAAAGTCGCCACAGCAGAGCAGCAGCTCGATCGGGCGGGACGGATCCATCTCGTTGATGAAGCTGACAG
TCGCGTAGATGTCGTCCAGCATGCCGTGCGCACAGCCCACGACCGCGACGCGCACCATTGTGATGCTCGCTTCCTACTGTCTTTGAATTTATTATTTCCC
TTTGAGCCTTATTGGTGAGCTAATAATGCCCCACGAGGAGGTATTATATTTTGATGTTTCCCTCGAAAATGCATGTTGTTCGTATCAGAGCTGGATAATC
ATTTACAAAGGGATAAAGTTAAGAACAAGTTGAAGAGCTGAATATGATAACGACACGAAGCACGAAGCACATCTCAGAAGTGCGCGATCGTTGCTAAAAT
AAACTCTCGCACGTGTCTTTAGTGCATACTGTAGTAGCGTCATTTGCACTCTCCAAGCCCAAGGCTCTCGCTCCAAGACAGCCGCGTTCATCTGATAAAT
GCCACACATAGTGTACTCTTTGGTTGAGGTGCGGTGCACATTAATATCAGCGAGTGCAACAACATTTGTAATAATGAACCCATTTTTGCCTGACTGACTC
TACACTGCAAGTATGTCAGTGAAACTCAGGAGCCAGCATGAAAACGAGCCAAGAGTGGGTGGGTGAAAGGTTTCCGTGCTTTTGGTCCGACTTTAATCTG
CTTCGAAAATGGGCACAAGCCTCATGTAGCACTACAATGGACTGCAACACACAAACGTCGAGGATACTCACATGTACTGTAGAAACTTGACTGTGTGAGT
GCGGATACGGATCTATGGTCCGTGGAATGAATTAATAATGCTCAAGTTACATGCGCGTGGGTGGATGTTGGTGAGAAATGAGGTATCAATAATCTGTCCC
AGTTGAAGTTGGAGAGACAGTGAAAAGTCTGCCGTTTCTCCTCTTCGCTACACAGGTATGCGATTTTACATCTCACAGCATATTAAATGCCTTCTTAAAA
CACGTAAATTTGTATAGAATGGTTATTTTACCTTCAAACTATCTAAAATGACATCATTTTCATAATAAATACGAACAGATTTGACAGCGATAACCAAGGC
TTCCTATTACACGAGGCAGTTGCATTACTGCCACGCCCGCAAAAATTTGTTCTGGTTTCGTGCCTTATCCATGCGCAAACGAATCCGCTGTTGCCATTGG
CGGAGCAGCAAGCATCCGTCTCGACTGATCAGCCAATCGGAGTTCGATTTACTTAAATCCTGCTTTCTTTATCATTTTCTATTGGTTAAAAAGGAGATGA
GGAAGAACACATGAGGGAGAGAAAGGGGGCAATTGAGTGACGTCGCCACGCACATCATCGCGGCTGTGTTTCTTCTTCGTTTCTCTATTTTTTTTTCCAC
ACTTTCCGCGGCTTCTTGCTGCTCCCTTTTCGCTCCGGTTTCCTCATTAGTGAATTTGCCGCGCGCCGCCCAAGACCCCAAGAAGCAAGCAAGCGAGAGA
GTCAGTCGGAATCGACACTTACGCCGTGCTCACTTGACCTCAACTTCAACAACTGACGAGAACGATGGTTGTCTCGCCATCATTCACATCGACACTCAAC
GCGAACGCGCCGGCGTTCGTGCCATCGTGGTCCTGGTACCCGGCGGACGAGTACTATGGCGATGAGAATCCGCTTTCGCAGGAGGAAAGCGAATTTGGCA
TCGCCGATTCGTTCTTTTCGGTGCAGGGGATCCCGGATGAAGAGCTGTTTGACGCCAAGTACCACCCACTGTCTCCAGAAGAGTTGCTCGAGTTGGAACA
GGTCGATGAAATCAATGCGATGCTCGCGGACCTTGACTTGCTCGAGACTCATCAAGAATTGCA