Description :
From Genome Similarity Track
Location :
Scaffold_839:703- 3211
Sequence
2508 bases(100 bases per row)
GTGACGCAGCTGTTTAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATA
ACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTT
CCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCAATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGC
AAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGT
GCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTGCCGGACCCGGATAGTCCGTTTAGCGT
CGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAGGGCGTGAACGCGTGATCGCGTTGAGTCTCGCCAGCTCAAAGC
TGCGGAGAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGA
TCTTTACTGATCATGCGTCGTTACGCACTGCGGACACAGGCACCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCG
AGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATACGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGT
GCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACAGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTG
TCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCTTCGTGTGGTCGTTCCTC
ATGATGAGGATCTAAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGAT
GTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATTTACGCACGTGTGAGACGTGTCAACAGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTG
GCGAGTTTGCCTGTCCCCAAGAGATGTTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGACAGGAAACACGGGCATTGTGGTCT
TTGTAAACCGATTGAGCAAGATGGCTCATCTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTGATTTTAGACCGAGTCTTTCGCCA
ACATGGCTTGCCTGAGGCAATTGTCTCGGCTCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATG
TCCACAGAGGACCATCCACAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTTGAGGATATCCTCCGAAGCGTATGTGCTGAGGCGCCAAAACGCT
GGGGCCAGATGCTCGCACTCGTTGAGCTCGCATTAAATAATGCAGTGCACTCCTCGACAGGCTACACTCCGCTCTATGTGAACGGCTTGGTTAACCCTCG
CGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGAAGAGATAGCCGAGCGGCTAGCTGATGTCAGCCATGTTGCGGCTCGCAAGCAAGTC
AATGACTTTGTCTCTTTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACATGCAAAAAGAACATGCAGATGCCAAAGGCA
GACGCAATGAAGAAAGGTTTGAGGTCGGAGATCAAGTTTTATTAAATGCAAAAAACCTACCTACTCATGCAGTGTCTGCGGTCTTTAAGACAAAATTGAG
ACCACGGTTCATAGGACCGTTCAAGGTCGTGGCCAAAAAGGGCCTAGCGTATACGCTTAACCTTCCGAAGAAGATGCGCACGCATCCAGTCTTCTACGTT
GGCTTACTCAAGCCGTATCAGGACCCTGCTCAGGTGAGCGCGGAGGCGTTGGCGCCAACGGTGGCTGGGCCACGACAGGCTGCTCATCTTGCATCGCAAG
TTCCAGAGGCGGTCACAGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCGGC
GTCGATGACGCGTGAAGAGTCTATGAGTCTGAAACCGCTCATGGTGAGCGTAAAATGCTTCGAAGGGAAGGATGGAGAGAATCTCCTTCTCTGGACTCGT
GAGGTCGA