Description :
From Genome Similarity Track
Location :
Scaffold_1827:703- 3126
Sequence
2423 bases(100 bases per row)
AGATCTGCCTCGTCTACTTAACTGGGTTCATCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGCCCGTATCTAGTTCGCTTCCCTGTCCTCA
TGTCGGTGATCTTCTCGACTTCGAACTCGTCGGCCTCTAAGTCCACATTCCAACTATCCTCCGGTAGAAGGACTTCGTCTAGGTGTGCGCGGGCGGATCC
TTCCACCAAAAGACGGGTTTGCGGCCGATCTGGATATTCTTTAACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCCGCC
GTTTCCAGCTTTACCGCATGTTCTCCTATCTTTCCGCTCACCCGGAGCGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGAT
CCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGCGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGCCGTTC
GTTCACCTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGTCATCGCCTTGGATCTCGATTTCTCTTCTTGGTGCTACATACTGGAATGGCC
GCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCTCGGATCCTGTCTTGGGTGGTGTTCATCGCGAAGGGGAGTCGTT
CTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTTGACATACATCTTGAGTGCTCTCGTGATCGGCTGCACTATGCGTTCGGCCGACCCGTTAGCTTG
GGGACGGTATGTCATGGTTGCTTGCTGTCTCTGCCCCAGGATCCGGTTGAAAAGCTCGAAAGAAATCAGTCATAAAGCCTGGCTCCCGATCATGTCTAAT
CATCTCACTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCGGCAATGGTTTGTGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCG
GTAAACAGACTCACCCAAATCAACAATTCTGTGTTTCCTTTGAGCGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCG
CTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCGCCGACATATCGTTGTACGCTCTTGAATAG
CCCCCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCACCTTCTAAACTAGCGTGATAGTGGTGTAGGACACCCTGT
TGTAAGGTTTTCGGCATCACCAGTCTCATCAGTCCATCTCGATCCTCGTTGACGCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTG
CGTAATCCGTAGCGATGATACTGTAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAAATCCACGCTTC
TTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACCCCCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAACCCTTCCTCTGGACCTAGTG
ACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGATCCTGACGCTCGGTCTCTCTCTCCA
CTTCGACACCACATTGATTCCGTGAAGCGGCACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAAATCGTGATTCATCCAACC
ACGCAGGTGGATCATCACTTTCTGCCGTAACCGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTTGCACCTGTCTGATCACCAGATTTGATTCCCAC
AAATCACCAGCCTTTTGGGATCTTGTCCCTTTAGTAGATCCAAACCTAGCAGGAGCCCGTTATACTCCGCTTGATTGACGGGTGAGGCCTTCCGCGTAAG
TGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAG
GACATACAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTTCTCATCC
ATCTTAGCTCGAGGAGTGATGCTCGCGGATAAGACTCCCAGGATCTTGTAATGTTGGAAATCCCACGTGAAATCTAGCTACAGATGTAGTTAGGATGTTC
CCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGCACCGGGACAAACTGGACCTTGTAAACTA
CTTATATAGGCCAACCAGTAAAA