Description :
From Genome Similarity Track
Location :
Scaffold_743:703- 1910
Sequence
1207 bases(100 bases per row)
GCCAAGAGAGTGTAGCACACTTTCAGCAATTGCAACAGCGCGACTACTTCTTTCTCAGCGGGATGATAGCCGAGTTCGTTCTCCTTTAGTACGCGTCCGC
AGAAGCGAACTGGGTGCAGCTTGTCGTCGTGTGGTTGCATCAACGTACTGCTCAGCGCCCACTCATTGGCGTACAACATTATGTGGACTTCTTTTGCCGA
GTCGAAATGACGCAGAATTGGAGCTTCTGCCGTCTTTTGAGCTCGGCGAATGATGCTTTTGCTGACGCCAGGTCACCCCCAGGGCCAAAGTCCGTATCCT
TTAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTGAGGGCACCGAGGAACGCTTGCATCCCCTTCTTTGATTT
CGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCGCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAGGAAATCAACCTTGGGTTGGATA
AAGATACGCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAGCGTATCCCCTCCAA
AAAAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATCAAGGAAGACTGGTCTGGTTCTCCATTAGCAAATATGTCGCCGTCCGGTCCGTTGAC
CAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGACTCCGCCGAGCTCAGCT
CGCCGAGTTCCCGACTCGGCTTCAGCAACAGCCATTCGTTCAGCAAACAACTGCCATCCTCCCTTTGGTTGAACATATCCCCATAGAGCGTTGTCAATCA
GTCGTTGGTAGATCATAGGCGCATTCTTCAATCTAAACGGCATTCGTAACCATTCAAAGTGTCCAAGCGCACAGACGAACGCTGAGATCTGCCGAGCTCG
GCGTGTCATCAAGACTGCCCAGAACCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAGCTCTTCAATTCGGTAAGCAGGTCATCAACCAGTGGCATA
GCGTATTTTATTGGTGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGCCGAAAATCCACACCATTTTTCTTGAGCACTATCACCACTGGCGAGG
CCCAAGG