Description :
From Genome Similarity Track
Location :
contig_4:70297- 75293
Transcript NameFunction/comments
g1193.t1hypothetical protein

Sequence
4996 bases(100 bases per row)
GCGACAGCAGCGAGCGACGGAGATATCTCCGTGTTGGACAGGCCGCGAGCTGCGCTCTGCTTTGCAGGCATAGGCACTCACCATCCTTGCCGCAGCGCAA
GATGACGAGTATCCAAGGCAACACACCTCACAAAGCGCCTATTTCGCTGCACGAGCTTAACTTTCGGCTGGCTCGGTTTCCGAACTGCTGAAACGCATGC
CGGCGCTTCCGGCCCCATCTCCAGTCCGCCCCGGTGATTCGCCCATTTCCCGTCCAATAGTGTGCATCCATTGGTCAAAAGTCTGTTTTATCAACGGGAG
GGGGCCGTTGCGGTCATTTCCACCGAAGCCTCCCATCGAGAAGCTAGCGCTGCGTGTGTGCGTGCCTCGAAGCGCTTAGCGGCAGTCCGCGAGACAGACA
GACGGACGCAGGGCCCGACAGGCATGCTGCGCTTCTAGACCGGCGCCTTCCTTTCTCTCGTCTCCGCCTCCCAAGAAGCAAGAGAGGAAAGAGCCCTATA
GTCCCTATTGTCTCCCTGCTGGATGGCAGACATCGCCATGACTGGAGAAGCCGGCGCCAACCGCACGTTCCGCTCCATCTTCGGCGACCAGGAGCAGCGG
CACGACGAGGTGCATAAGCTGGAGCTGGGGCAGAGCGTCAGCAGCAGACCCGTCGTCACCGACTCGGGTGCTGGACTGGCCATGGACGACGACGACGAAG
CCATGTGGAGTGACGAGCCGCCGCTGGGCGATGCAATAGCTCAGGATAACAACGACCTGCCGGGGCTCCAGTTCGCGGTGCGTTGTTGGTTGTTGCGAAA
CGGCTAGGGAGTGCCAACCTTTGAATTGACTTTTGGTGTTTTTGCTTGCGATTCTCAGCAACGCAAGTCCATGGAAGAGTGGGCAGAGGATGATGACGAA
GAGGAAAACTGGAAGGATGCACTGCAAGACCGCGTCAACCAGCTGGAGCTTGCGTTCCAACACAACAATGACACCGCTGCAGCAGACTCCCGGCGTCGCT
TCGAGCAGCAGCAACTGCTGCAGTTTTCAGCGCCTGAGACGCATCACATCAACTTTGGCCAGACTCTCCCGGTCTCAGCGCGCTTCACCACGACGAACTT
GGGCTCGGAGCGCTTGCGACCAGCTAGTCGCCATAAGATGCAGCGCACATCCTCGTCGCATGCATGCATCACTGGCGAGGCTGCCGTTCAAACTGCGTCT
GGACGCTCAAACCACCTCTGGAATTTCCAACGCAAGGTAGCGGGAGGGACCACACCGACTCCGATCGCTCAAGATGCACGCAAGCGGTCAACCTCCATAG
ATTTCGTGGCCCGCAACATTCAGACAGTCGAGCACCATCGCAAGCGCTCCGGTTCTTTGAGTGGGGCATCCAGCAGGACCGATTCGCCTCGACATTCTCA
GTCCCGGAAGAATTCCTTGGACAGTAATCACAGCAGCCTCGGCCGAAGTAATAGTAGTAGTCTCCACGGGAACACGGCAGCTGCACCAGCCGACAGCACA
TCATCAGGCGCGGCGGTATTTAACCTGAGCGACACGGAAGCCATTCGCCGTTTTGTGCTCGACGACGTCAAAACGGTAAGTCACCCCTCTCTGTCTTGGA
ACGCTTGAGGCTGCGCTCTGACATTGTGCTCTGCTGTGAATAATGCAGATGTCCATGGAGCGACTGGTAGGCGACGCCCAGCGCTTACATTTTTTAGAGG
ATTTCTACCAGAATCACCACGCACCAGGCCCCGGGCCGGCCGCCGCGGCGCCACCGTCGCCTTCCCCCTCCTCAGCTATGTCCACGTCCTGACCGCACTC
TGTTCTATTACATTCCTTTGCCTTGCCTTGCTGTTCGGATGCGATATTTTGCTGCATGCTCTATTTAACGACATTTTAATCTTTGCTGCAACGCACGCCA
TGTGCGTCTTCATCTCGTTTCTTGGTTTGTGTTATGCTTCATTCCTCTGCGCAGCATCTAACTACGCTACGTGCAGGCTGCACTGCAGCCTTGGGCTTGG
TCACGCCACCTGGGCGCTGACTGAAATCGAAGGAAGCAGCGACCTCAATCGCCCGTACGATTTGGATGCAGCAAGAATCCTTCTCTATACACGGGCAGCG
AGGTGTATTCACCTCCAATCTTTCGATCACAAAGCCGATTGATTCATCTACGACAGCTCGGAGGTGACCTCCGCCATCAACCTCCGATACACCGGCCCCT
CCTTCTAGTTGGAGGTATGGGTAATGCTGACATCTTAGCTTCGCGTTCTTTTTGACGGACGTGGAGATCACTAACGCGTAACATGCTGACCTGTGTATTG
CTTCCCAGGCTCGAATGCTCCTCGAAGGCGCTCTCGCTGTAGAGAAGACAATCAGATTTGCGTCGGCTTGAGAATTACTGCGATGATGTGGAGAGTGGCC
AGTTCTCATACGAGAATACTCTCTGTGTAACCACGATATGCATGAAATGTAATGTGACTAGAGCTGTCGTGGTTAACTAACCTCACCTCTAATCGACCCA
CACCTCTACCTCTGGCCTAACCTCTATATCTGTGGCCCACACATTATTATCATACAAAACCCAAGTATAAACTAGTGTTGGCGAACACAAAGAACCCCGT
CCGCAACGACATTGGCGAGATCAAGCTACTGGAGGCTAAGAGCAAGGAGGATGTCAAGCAAACCAACGAGCTGCCCAAGGGGATGAAGGCGCTGTAGCAC
AGCGACAAAATGATGGCGCAGTCGATGGCCTTGAGCGGCTGCAGCGAGACCAACTACCGTACCGTACAATCTCCAGACGTGCCAGAGGAAGTTCCTCCAC
GACATGCATATCTTCATGCAGCTCTGCTCCAAGGTACAGGGGAACTGTCGTACCGACGAGAGCGACGAGTTTGGAAATGCGCAGTGAAGAGACATTCAAC
TTCGTTGCGGCGGCACTTTAGTAACGCGTATTGACTTGACCAAGTATTTCTCCACTATGGCTAAGTCATCGTCTTCCTACATCTTCCTATCGTGAATCAA
CACACTCACACCGCCGTAATCGATCAAGGAACCCCATGCATGCCTTGCCTATCGGGTGAGAGCTCACCTGTTTCGGTTGCCTTCGTCATGCATCCCTGTG
AGTTGAGGTCATCCGTGAATATGAATTCGAACGCAGTGCTTGTTCGAAGCAGATCCTCTTGCTCGACATCGGCACGACTTGCTTGCTATCAAGGCGGTAT
TGATGCCAATAAGGACCGAAGACATGTAGGGCACAAGTGTTGTGAAAATGACTCATGTAGTCCGTTTCCGAATCACGAAAGCAATCGTCATATTACACCG
CTTTCAATACACGTAGAGTGACCGTTGTCAAACTCTTCGTCGGAGATACCAGTAGTTCGGATGAGGAAGCATTTGAACAAATAACCACAGTTGATACTTG
TGCTGGCGTCGTGCCGTAAATAACCGCGTGGATCACTATGAAGCCGTGTCCCGGGCTTAGGAATGCTCCAGAAGCGTACAGCTAGGTCTAATTTCGGATC
GCGTTTGGGTGCGGCTGCAACCTCCTGAAGAGTGGCTGTGGGTCTACTGCTTGATGCGCTGGCAATGACGACATCACTTGCACCTGTTACTGTTTCTTTA
GCTGACAAGGTGAAGAACAGGACTGAGGATGCCGCTGTCGTGTAGGAACACGTCCAAAATATGTATGCACACTCCCACCACCAACACCCACCAAATCCAC
GAGGATTCAATGAGCTTTGTCGGGCAAATAGAACCTGGAGGCCCTAGTTCTCGCCCTTACACCGGATTGGATGTTTCCTCTGCGTACTGTGGTTTCCGTA
GGCTAATAACCAATATCCAGCACCACTAGCCACGAGCGACGGCTAGGATGCTCTTCTCACACTGAAACCTCGTTGTCCCTCAGAAAGGAAGGGTACGAGC
CGGTCAAGGTCTTGTACGAGGTGCCGGGGCTTAACTCCGGCGGGAAGAATATATGGGACGCACTCAGGCGTTCCCAAGTGCCAACGAGTTCTCGTTGGTC
TTCTATCACACGCACGGCCACTCTCTCTCTCTTCTCTTGGCCTACCAGATAAACACTAGCCCACACAAACTACGTGTTCACCAACATACAGTTCCTACCC
TACCGAGCGGGACCAGACGCTCCGGACACTTACCGAAGCCGGACTTGACTCTTGAGTGGTTGAGAGGAAAATATGTTCTGTTTGTTGTTGCCCAGTGGCC
ATTCCTAATGCTATGCTTTCCTATGGTTCCTATACAAATATCTAGTGTAAACGAGTCCGTTACGGATCTTCTCCGTAACCTACGAGGACTCCACCGTCGC
CGACGCTTCGGAACAGTCGAACGACGACTCGGACTGGTCGTTGGTTTTGGACCTTGCCTCTAAATACGCTCTGCGCATCTAAGTACGGAATCTCGCCCAC
TAAGTTCGGTTCACGTACTTAGCTGTTCGCTGATCACCATTCCTCGCCATGTCCAATTTGTGGCCAATGAGCGAGCGGAGAAGCCTTTTATCAGTTTGAC
GAGGTTTCCCAAGTCATTCTTCGCAGCAACGCCAGCTTCCAACGGCAGGACCCACGCTGCGGTGAATTCCTACACCACACCGCTGTCGTTTGCTCTGAGA
GGTTAGCGTATTGGGGGCTGCACCGTAATTGTTAGCTTGAGGTGTTCTGGAACGGCTGCGTAGCGGGTAGCGACCAGAGGTCGGAGGCAGACTTGAAGAT
CCAGACGAATCTCCCAGGCGCAGCCTAGGCTCCGAACGAAATCCTAGAGTTGAACTGGCCTTTATAGAGCTACTGCGGCTGATGCTGCCGTGCATGGGCG
AAGACGCTCCGGTGTGCAGAGAGGTGAGCGCGACATCCGACCGGAGCTCTTCCATTGTCTTCGATCGCGATTCTATTGCTTGTAGCCTTGAACTCAAGGA
TCCAAACTATGTTTACTTGGATTTGTATGGGTGTTAGCTAGAGGTTAACGCAGGCTTGGAGATCCGTGCAGGTTGTTCGAAAAGTAGTTGTTAAGC