Description :
From Genome Similarity Track
Location :
contig_24:702916- 705372
Transcript NameFunction/comments
g5796.t1ETK87814.1 hypothetical protein L915_07800 [Phytophthora parasitica
g5797.t1hypothetical protein

Sequence
2456 bases(100 bases per row)
CGTCCTTGCTGTCGTCGCTGCTGCCAAGTTTGGTCCGGGCTGTAATGAGCTCCAGCACTTGCCGAGCTTCGAGCAGCCAGCCCGTAGAAAAGGTGTCAAT
GGCTGCCACTAGTGCACACCGGATAGCAAACCACTCACTGTCTCTATCATGCAGGAAATCCACATGTCCGCGGCGTTCGTAGATGTCCCGAATACGTTCA
TATCTCTCTTGCACCGTAGCGCCATCCGTGCCATTGTCCGTCGACGTAGCAGCTACATGTGCGATGTGATCCACGTCTGCGTCATGCAGGTCACTGAAGA
AGAAGTGGCGCTCCAGCATCGCCAGCAAGAAGGTCATCATCTGCTCGCCCAGAGCCACTCCGGGGGCCACCTCCTTGCCGTGCGTCTGGGCGAACGTGCC
CGTATACAGCGACGCGAACAGCACCAGCGTCTCATCTAAGTCCCAGATGAACACGCGTCTCCGCGCACGAGGTTTCGTGAGGCTTTCATCTCGCACAGCC
TCAACCTGCGTCTTCTCGTCTTCATCTCCAGCTTGATCATCCTCTCTCCCCTCTTCCTTCTCTTCTAAAGCCTCCACGTCGTCTCTCTCGCTTGGCTCCG
ATCTCTGTCGCTTCATGGGGCGTGACGTCGAGTAGCTGTCGTCGTCCTGTCCACGGACGTCACCGTCTCGCTTGCCACCACGGTTCAGCAACTCGCTCGG
CGGCTCTTGGAGCGGCGTCACGACCGCCTCGAGCCTCTTGGAGGGCAGCAGCGCCAGCAGCAGTGACAGCAGCGTCGCCCACAGCCGAGCGCGCCACTGG
AGCGTTTTCAGGCGCCGGCGCTGGAGCGTCTCTACCCACTGCAGCCCGAGAATGACCGTCACGGCCCCGCAGAGACTCACGCCCACCACCGGGAGCAGCA
CCAGCTTGGCCACGGCGTCGCCCAGTCGCGCCATCGTTAGCAGCAGCGTCTTGTCCTTCGTCGCGAGCTTGCGCGAGTGAGCGCTCAGGGCCAGGGTCGC
GTCGAGCCGCGCTTTCGTTCCGAACGTCTTCATGACCGGAATGCGTCACTGGCGAAAAGTCCAATAACAATGGAAGAGCCTTTTCATAGTAAGAAACAAA
GACAAAGCGCGCTGTATTACGGAAAGTGTGTCATCACTACGGTTGCCTTTTGACTGTGTTCATCTTGTGGAGATACTTGTGCGCTGTTGCCATCTAGGAC
CCGTGAATCTACACGCAAGCAAGGGACAAGCACGTGATAAGTGAGCTACCGCATCGAGGTCGCCGTCTAGATGAACAGTTTTGTAGAGCGGCGCAACTTG
CGCTTCACTCGTTGAACGCGCACAGATCGACTGGCTGGCAGGTCGGCCACGTACCGCACAAGACAGGTCACGCCATTGCTGCAGCACCAATGGAAGCTGC
TGCGCCTCGCTCGTCGTATTATTCGGCACGTCCCTAGACAGTAGCAACATTAGTGGACACCCAAGCCAGCCACAGCTTGTCGGGACAACCCACCACCACA
CGAGCTCGTTGAAATGGTCCTCGACCTCCCAGATACGGCCTTCGTCATCAGTGTGTCGCAGCCCACTATCTTCCAGTACGAGGCCTGGCACACCACACCG
AGAACCGTCAGTGGGACTCCCTGAAACACCGCCAACCAGCACAACGCACCGGTGAAGCCCAAGGGCGCCAGCGGCAGCTTCTGGCCCTGCAATTGGATAC
CGCGGAACTCCGCGCGCAGCATGTCGTCCTGGTCCTTGTCGCTCTTCTTCTCCGTTTTGACGTCCTGCTCCTCGGATCCCGTCCCGTGGTCGGTGCTGTT
GCTGTTGCCGTCCCCGCACTGCGGACGGAAGAACGTTTTCACGGCTGCCGGCCCGTCGAAGTGGATGTGGCAGGGCAGCGAGTGCACGCGCTCCTCCGCG
GGCGGCAGCGGACATCGCGTCAGACACACGCGCACAGCTCCCGACGCTTCTTCTACCATCGTGCTTGAAAATGCAATTATTGCAATTATCGCGGGAACTA
TATTCCCGCCAAACAATTATAGCCAGGATAAACCTTCGACGCCGTGCAATGGATGCGGTTGGTCCGAGCGCTGCCTGAACGCTCTGTCGCTTCCACGAGC
TTATACAAGGCAATGCCCTTCTCTGTGTGTGATGCTGTATGGCACAGTCGAATGCACCCGCGAAGCGCTCGCGCGACGAAGCCAGCAAGCTGCTGGGCGA
GAAAATGCTGCAGGTTTGGCGATGGAGACGCTCTTGGCTGGTATTGCAAGAGCTAACTGGTTGTGGATGGAATAATTGCTGCAGGGCTGGACGATGCTGG
GCGCCAGCTGCCCCGTCGAGGACTGCTACACTCCTTTGATGCGTAACAAGCAGGGAAAGGTGGCGATATAGCTTCAGACTTGGTGGCGTTTTGGAAGATG
TGCAGCTGACGGTGATATGTGCTCTCGTTGGTAGATGTTCTGTGTGCGGTGCGAGC