Description :
From Genome Similarity Track
Location :
contig_24:702904- 705360
Transcript NameFunction/comments
g5515.t1ETI47894.1 hypothetical protein F443_07972 [Phytophthora parasitica P1569
g5516.t1hypothetical protein

Sequence
2456 bases(100 bases per row)
CACGTTCACATTCTCCACCTCCTCTTCCTCGTCCTTGCTGTCGTCGCTGCTGCCAAGTTTGGTCCGGGCTGTAATGAGCTCCAGCACTTGCCGAGCTTCG
AGCAGCCAGCCCGTAGAAAAGGTGTCAATGGCTGCCACTAGTGCACACCGGATAGCAAACCACTCACTGTCTCTATCATGCAGGAAATCCACATGTCCGC
GGCGTTCGTAGATGTCCCGAATACGTTCATATCTCTCTTGCACCGTAGCGCCATCCGTGCCATTGTCCGTCGACGTAGCAGCTACATGTGCGATGTGATC
CACGTCTGCGTCATGCAGGTCACTGAAGAAGAAGTGGCGCTCCAGCATCGCCAGCAAGAAGGTCATCATCTGCTCGCCCAGAGCCACTCCGGGGGCCACC
TCCTTGCCGTGCGTCTGGGCGAACGTGCCCGTATACAGCGACGCGAACAGCACCAGCGTCTCATCTAAGTCCCAGATGAACACGCGTCTCCGCGCACGAG
GTTTCGTGAGGCTTTCATCTCGCACAGCCTCAACCTGCGTCTTCTCGTCTTCATCTCCAGCTTGATCATCCTCTCTCCCCTCTTCCTTCTCTTCTAAAGC
CTCCACGTCGTCTCTCTCGCTTGGCTCCGATCTCTGTCGCTTCATGGGGCGTGACGTCGAGTAGCTGTCGTCGTCCTGTCCACGGACGTCACCGTCTCGC
TTGCCACCACGGTTCAGCAGCTCGCTCGGCGGCTCTTGGAGCGGCGTCACGACCGCCTCGAGCCTCTTGGAGGGCAGCAGCGCCAGCAGCAGTGACAGCA
GCGTCGCCCACAGCCGAGCGCGCCACTGGAGCGTTTTCAGGCGCCGGCGCTGGAGCGTCTCTACCCACTGCAGCCCGAGAATGACCGTCACGGCCCCGCA
GAGACTCACGCCCACCACCGGGAGCAGCACCAGCTTGGCCACGGCGTCGCCCAGTCGCGCCATCGTTAGCAGCAGCGTCTTGTCCTTCGTCGCGAGCTTG
CGCGAGTGAGCGCTCAGGGCCAGGGTCGCGTCGAGCCGCGCTTTCGTTCCGAACGTCTTCATGACCGGAATGCGTCACTGGCGAAAAGTCCAATAACAAT
GGAAGAGCCTTTTCATAGTAAGAAACAAAGACAAAGCGCGCTGTATTACGGAAAGTGTGTCATCACTACGGTTGCCTTTTGACTGTGTTCATCTTGTGGA
GATACTTGTGCGCTGTTGCCATCTAGGACCCGTGAATCTACACGCAAGCAAGGGACAAGCACGTGATAAGTGAGCTACCGCATCGAGGTCGCCGTCTAGA
TGAACAGTTTTGTAGAGCGGCGCAACTTGCGCTTCACTCGTTGAACGCGCACAGATCGACTGGCTGGCAGGTCGGCCACGTACCGCACAAGACAGGTCAC
GCCATTGCTGCAGCACCAATGGAAGCTGCTGCGCCTCGCTCGTCGTATTATTCGGCACGTCCCTAGACAGTAGCAACATTAGTGGACACCCAAGCCAGCC
ACAGCTTGTCGGGACAACCCACCACCACACGAGCTCGTTGAAATGGTCCTCGACCTCCCAGATACGGCCTTCGTCATCAGTGTGTCGCAGCCCACTATCT
TCCAGTACGAGGCCTGGCACACCACACCGAGAACCGTCAGTGGGACTCCCTGAAACACCGCCAACCAGCACAACGCACCGGTGAAGCCCAAGGGCGCCAG
CGGCAGCTTCTGGCCCTGCAATTGGATACCGCGGAACTCCGCGCGCAGCATGTCGTCCTGGTCCTTGTCGCTCTTCTTCTCCGTTTTGACGTCCTGCTCC
TCGGATCCCGTCCCGTGGTCGGTGCTGTTGCTGTTGCCGTCCCCGCACTGCGGACGGAAGAACGTTTTCACGGCTGCCGGCCCGTCGAAGTGGATGTGGC
AGGGCAGCGAGTGCACGCGCTCCTCCGCGGGCGGCAGCGGACATCGCGTCAGACACACGCGCACAGCTCCCGACGCTTCTTCTACCATCGTGCTTGAAAA
TGCAATTATTGCAATTATCGCGGGAACTATATTCCCGCCAAACAATTATAGCCAGGATAAACCTTCGACGCCGTGCAATGGATGCGGTTGGTCCGAGCGC
TGCCTGAACGCTCTGTCGCTTCCACGAGCTTATACAAGGCAATGCCCTTCTCTGTGTGTGATGCTGTATGGCACAGTCGAATGCACCCGCGAAGCGCTCG
CGCGACGAAGCCAGCAAGCTGCTGGGCGAGAAAATGCTGCAGGTTTGGCGATGGAGACGCTCTTGGCTGGTATTGCAAGAGCTAACTGGTTGTGGATGGA
ATAATTGCTGCAGGGCTGGACGATGCTGGGCGCCAGCTGCCCCGTCGAGGACTGCTACACTCCTTTGATGCGTAACAAGCAGGGAAAGGTGGCGATATAG
CTTCAGACTTGGTGGCGTTTTGGAAGATGTGCAGCTGACGGTGATATGTGCTCTCG