Description :
From Genome Similarity Track
Location :
Scaffold_130:70272- 72945
Transcript NameFunction/comments
Hyaar_Emoy2810582unnamed protein product

Sequence
2673 bases(100 bases per row)
CACGAGCCCCACAACTTCGGGCCAGGAATAGCGTGCTACCAAAGAGTGAACCCGCTGTGATCGAGCAGTCTGCAATGGGACCCGTGACCACCACCGGGTG
CAGCGAATGCCGCAGTGTGTAGAACGCAAAGCCACCTTGGCGGCCTTTGAGCGATGCAAACGAGTGCGTTGGGGACAAGGCCTCGACTTGGACCGAGATC
GTTCCCGTGCTGGCATTGATATACGTCATTTGGCGCAACTGCAGTGCCTGCTTTGGGTCTGCTGCTGTCCTGGTGATCTGCTGTTTCAACGGCTCGCTCG
CCTCAAGCAAATAGCTCAAGAGGTAGTCGTAACTCCAGGTACCGACTTCGTCTTGACTACCTGCAACCGTAGCGCTCGCTTCCCATGGACTCTTGATATC
AACGTCGGTCATCTCGATGTCGTAACCCATCTCTCGAGCAATCATGATTGCCTTCTTGGCGCTGCGTACGCCCATCACGTCGTCGATAATATCACGCACG
CTGAACTCGTTCTTGTACTGGGCTATGACGTCTTTCATGATCGTTTCCAGGTCCGCATGAGCTGGGTCAGGGCCTGCAAATACAGCGTCGAACACAGCAT
GCAAGAAGCGGCTTCCCGAGTACTCGACCCGCTGGATGTCGTCACCTGTCTGGATAAAGTTCTGGATCGTATTGAAGATGGGGACCCCGATCGCGAGCGT
AGCCTCGGGATCGTACGTCAGCTCGTTCTCAATCGCTGTTAGTTGCATCGCGTTGTGCAATGCCGTTGAGACTGAAGAGACGTTGATGTTGGACGTCATG
ACGTGGACCTTGCGCTGTAGCCATTGCGGGTACAGGTCCTGCACATGATGGAAGCTGTTGGAGACATCAACGATGAGCCAGTGGGGTAGATGGTCTACGC
AAACGTGGTTCAAGAACTCGCTCCAGTCGAACGGCACAAACTCGTTCTTCCGAGTTGCCAAAGCTTCTTCAGTGATATCACCGTCAGTGTCTAGCAGCAT
CTGAGCTGACATGTGAGTTCCGATGGCACGTACGCGGATATCCACGTTGAAGCGCTGCTTGAGGAACTCGCGCTGCTGGTGGTATTGCTTCAGTAGTGCT
ATCCCAATGCTGTTGGTCTCGTTCTCTTCGAACTCGAGACCTACTACACCGATGGAAAGGGTCTGATCCGACAAGAAGAAGGACGAGTGTGCAGCCCGAA
GAGCTGCAGCCGAATCCTCGTAGCGAACTACTGCAGAAATATTGCGCTCGGATGATCCCTGCGATATTGCCAAGACGTTGATCTTTGCACGGCCGAGTGC
ACCAAAGAAGCGAGCACAGACACCTGGAGTCTGGTTCATTTGATCCCCCACAGCGGCAATGATGCTAACGGGTGCAATGTACTCGGCCTGGTCAATGTGC
CCCACGTGAATCTCTTTGAAGAACGTCTCGTTAATGACGTCTTTCGCGACCTCGGCACAATCCATGGGCACGGCAAAGCAGATCGAGTGCTCGGAACTGG
CCTGGGCAATGAGCACAACGTTGATCTTGACGCGATCTAGTGCACTGAAGAGCCGTGACGATGTACCGTGCACACCGACCATGCCGCTTCCTTCAATGTT
AAACAATGCAAGATCATCTACCGTGGAGAACCCACTCACGATATTCCGTGCAGTGGGAGCACCATTGGACATGGAGCGATTGAGCTCGACCTTGTTGCGG
TGAGAGATCTTCGTGCCCGGGTGGTCAGGTTCAAATGTATTCCGGATGTAGATGGGGATACCTTCGACAATGGCAGGCGCCATGGTCTTTGGATGGATCA
CCTTGGCACCAAAGTACGCTAGTTCCATTGCCTCCTGGTACGAGATCTCGGGTAAAATGCGCGACTCGGGCACACGACGTGGATCGGCACTCAATACACC
GCTCACATCCGTCCAAATTGTGACACTGCTAGCGTGCAAGACACGCCCACAGATTGAAGCTGTAAAGTCGCTGCCGTCGCGCTTGAGGGTCGTCATGACA
CCTTCGACTGTACTGCAGATAAAACCCGTGACGACGAAGTGCGTGAGTTCCTCGCCTTCTTGTCCATTCTTGACAATCTCATGCATCTTCTGTATTGACA
AGTTGTACTGCACGACCGGTCCGTGCTCATTGTTGGACTCGACCGTCAAAAAGTCACGGGCATCTACGAAACGAAAGCTGTGCTGCTCGCCGTTCACGTC
CATTTTTTCGCTCAAGACAGCCGTGAGGATCTTGGCCGACCAGATCTCGCCGTGGCCAGAGACGAACTCGACCACGTTGTCGTTGTATGCTTGCATGATC
GAGATCGAGCGAAGCAGCTCCGAGACCGACTGCAAGTCGCGCTCGATATCCTTCTCAATGAGCTCACCAACGTCTCGAGGCAGCAGCGCACGCACGATAT
CATGGTGTTTCTTGCGAATTGTAGCCAGAATCTCGTCGCACTCGACAGTGCAGCGCTGTTTGGCCAGCGTGAGTAGCGAAATGAGCAGATCCGTGACCTT
GGGCTTGCCACCGATGGCCGATACTACCACTGCAATGCGTGGATCCTTTAGCCTTGATACAATGTCCGCGACCTTGGCAAAGCAGTCGGCATTGCCTACA
GACGTGCCGCCAAACTTGTGCACGACGAACTTGTTGTCGGTCATGTTATACTTGTCACGCGTGGGGGTATCTG