Description :
From Genome Similarity Track
Location :
Scaffold_360:7026- 8674
Transcript NameFunction/comments
g13697.t1KUF79767.1 hypothetical protein AM587_10008395 [Phytophthora nicotianae

Sequence
1648 bases(100 bases per row)
CCCATGAACGGGTGAGACCGTCGTCCATGGTCGCTGTCGTGAGCCTTGACAGCGCATCTGCCTGATTAATCGCCGCTTCGTTAACAAGGAGAAGTGACAA
CCACGCATTGCTAGTGTTGTCACCCGTGACAATCGCCTCCTTCGACAGGATGTCATCCCATTCCTCCTGAATGAATGCAGTCGTGCGCACCAGACCATTG
ATCGGTGACACAGGGATCATCTGGATGCCGTGGATACAGTGCTTCTCGGCACTGAACCACGTCGCGTAGTCCGCCTTATTGTCGAAGAAGATGCCCGTGA
CGTGGTTGGGCACGAACTGAGGCGGGTGAATCGTGTTGTCCGACGTCATGAGGAAGTAGGTGCGCACTGTACGCGCGTTGAGGCGCAGCATGAGGCTCCC
CAGGTCCTCCACCGCCTTGTTCCCCGCCGCCTTGCCCCACAGCATCATACCGTAGTAGAAGTTCACATCCTCCGACGTGCTCTCTTCATCCTTACCATCA
GCCATGGGGGTCACGCCGTGCGAGTAGGAGTGACCCAGAAACCAGGAGAAGTGGCGGAACTTGGGGAAGTGTGTGTCCTCCGAGCTCGGGTTGGCCACAT
CGCGGAGCAGCGTCCACACCATCGTCTCGAGTTGAGCCATGCCTGACCATGTCGGATCCAGCTTTTTCAGGATGGCCGACGCTGTGATCCAGTAGCCGTA
GTGGTAGTGATGGTCGTTGTACACTCCGTTACCAAACTCTACGTTGACATCATTGTTAGTGAAAACCTGGCTTGTCACAATGCCCTTGTACGTTGTCTCG
TACACCAATGGGACGCTCAGCGTGTTGCTGACAAAAGGTTCGATGAGTGCCTCCAGCTTCGATAAACAACTACTCAGGAGTGTAGTGTCATCTCCCACCA
CTGAGCTGTCGGCGGCCATCAAACACAATGACGCGTACTTCTGGTACGCCTTGCCGTTGTAGTACCAGCTGCCAGTGTCCAAGCTCCAGTCACTGTCAAT
GTCGCTCTGCAGCGTGGCGAGAAGACCAATCTGCGAGACCACGTCGGCAGACGGCTTGTTGGCTGGGTAGAAGTCCACCTCGTCGTCCGCTTCGTCCTCC
GTCAGCGTCCAGCTACCAGACGTGGTTACCTGGCCCACCATGTCACCGCGTGTACTCGAGTGCAAGACAATTGCTCCACTCGACTGCGCCGCCGTGGCAC
TGCTCATGACCTCCACTTGGTGCGGCAGTGCAAAATGCAGAAGACCTGTGCTGTCGCACCCACTGCCTTCCGTCTCCCACTCCAGCGAGTAACTCGTGCG
AGACTGCACCGACACGTCGCCACCGCACACAATACACGACGCGTAGTCGTCGTACACGTCCTGATCGCTGTTTTCGGGAAGAATTGCCACCCGTAGCGTG
CCGGTGTAGGCGGCCGCAGCCACCAGCGCCGACCCCGTGCTGTCGATTGAGAACGACGCGCTGGTATCGCTGGCAAAGACCACCCACGTCTGGCGTTCGC
GAGCTGCACGACGAACTTGCCTGGCGTCGAGCTATCCAGCAGTGTCATGGCGTAGTCGGACTGGATGCTTGCGGTGAGACCAGCGTACGTGGCCGACACG
AACGCCATGCCGTGCACCAGCGCCGAGTCCATGCAGGTCGTGCTGCTG