Description :
From Genome Similarity Track
Location :
scaffold_11:70252- 71494
Sequence
1242 bases(100 bases per row)
AGCCTTGGGAAGTCGAAACTTCAATGTTGTAAAGTCGTTTGTTTCGATGAAGTCGTAATGCGCGAAGTACACAACATCCTACAATAGTAAAGATTGCATA
AAATGCGTAAGTTCCATCGTGTTGTATAGTAGTATGTTGAAGTCGAATAGAGTTGGGAAAGACAATTATAGACCAGTCGAAAGTTTCAATAATGGACTTG
TCAAAAGGTCGAAGAAAGACTTTTCATTGATGTATTGCCGCTCTGCAAGCCCAAAAAACTTTCTGGGCATCTTCCACATTTGTGCATTCATGTACACATG
AATTGCTTGTATAAATTCCGTTCTCCATCGAAACTTGTATCAGAATTCTAATAAATTGTGTTGAGGACGGGTCTTAAGATCGGAGCATACTGGGAGTACA
TGACAATCCGATTGGTACTCAAAACGCCATGTATTGTCCGTAAGAGTAATGCTCGCGATCTGATGCTTGTCAACTTGGAGCTTTGGAAGCAGTGTACCTA
ACTTAGTCTTCAACAATAGTTAAAAAAAGTCTCGTTCGGACATGTCTATGACGATTTGTCTTCAAAAACGCCAGCCGTGAGTTGCCCATTCAATGTGAAT
GGGGCACGTTGGCCCATATATAGGTCCATGTGGGGGGGCAGATCAAGTTAAGTCGCAAGATTGTGTCGAACACTTATCGTGTTTTCGGTGCAGGTCTGGC
GAACTGATCCACCTGAAGTAGACTGTTTAGTAGATCTTGTGTCGCAAAGCATCCATAGCGTTCCACAAAGTCTTGTAGGTGGGTGAACCCTTATGCTTTC
AGAAAGCCAATAGTGCTTTTACTGACTTCGGCCAATGGGGTTTCATTATGTCATGACTTGCAAAAACCGTTCCCATTCCGTGGAGCCGTGAGTAGTGCGC
AGTTCCGCCCATACACCTAGAGTAGATTTCCAAAACTCAGACAATTGATTCCATTGCTCTCCCTTCATATCTGCATATAAAACATCAAAGCCTGTACCAA
GGGAGCCTaatgttcttgtaaagagttTGAGTGCCGGAGTAAACCATCGGGGTGCAGAATTTAATTCACAAGTCATGGCAATTCCATCCCTTAATGTCTT
GAGGAGCATAATGTGGATAAAGGCTGTAACAGGTGTCAATCCTAATCCACCCTTTGAAACACACGTGTAACTTCATTCTTTAGCGAATTTTTCGGCAATC
GCGGAGTCACTATCCGTATCCTTTGAGTGAACAAAGTTGCGG