Description :
From Genome Similarity Track
Location :
Scaffold_19:70244- 75408
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.11Serine/threonine-protein phosphatase

Sequence
5164 bases(100 bases per row)
CTGCGGTCTGGTGGCCCCAATGGACACGGAGGGTCTCTCGACGCGCGGCTGGGGCGTGGGCCACCTGATGATGGTCGCGCCGGACGACGAGCTGCCGGTG
AACAACTACAACGAGGACCATAAGCTTATGGAAGGCGCGCTCATCAAACTCGGCGACTACGCGCACTTCCGCTACTTTTTACTCTATCGCAACGGCCGCT
TCTGCTATTACGAGTTACCGATCCCCGCGGGCGGCGCCGGCGGTGGCAACCGACGTGTGCACCTGACGCTCACGTCCGAGCATCTGCGTGGAGTGATGAT
GCTGAACGCGTCGATCCACGCCAAGGAGCTCGCGAAGAACGAGGACGAGTACGACGCGGATCTGATCAAGCGGGGACTCATGTTCAACCGCAGGAAGCTC
GAGATGAACCTCACGGGGTACTCGCCCACGGGCCAGCTCATGTCGTGGAAGCTGCGCGCATCGAATGACGCAACGTACACAAAGTGGGAGCGCGCGTTCC
GACTCGCCTTGCGTCCCATTTGGGTGCAAAACACGCCTGCGTGTCTTGTGTGTCAGAAGGCGTTCTCGTTCCTCTTTCGCGCGCATCACTGCCGGTACGT
TCTGCGTATAGTTGCTTGTTTTGTCGCTGTTGTTGAGCATCTGTCCATGATATCCTAACCATTGCATTATGTGTTCTCGTATTGCGCAAACTAGGAAATG
CGGCACGTGCATGTGCGACGAATGCTCAGTGCTTGTGCCGCGATTGCCCATGCAGGGCTACTATGACGAAGTGCGCATCTGCCGGGACTGCTCGCCGATT
CGCATCCAGCGGTCGTCGCTCAAGATGGACACGCGCGTGCTTGTGTACGGCTCATACCCGGGAAGAGTGATTCAGGTGGACGCAGCAGACGACTCGGAGG
AAGGCCACGCGTACGTGAACGTCGAGCTTGAGAAAAGCAGCGATGTGCGCAGGTTCCCGATTGAATACGTGGAGCTGTACTCGGAAGCCGTTCTGTCAGC
GAACCGCATTAAGAACGCGATTCGAATGCACCTCTCGCAGTCACTTTTCCGCACGCAGCTGAACTTCAGCACGTGGAACCTGCTCGAAGCCGTGCAAGAG
CAGAAAACCGTGCAAATGGTGAAGATTCTGAACAAATCGACGAGCATCACGGAGCTTCGCTCCATGGTACCCAACCTGGGCTCGCTCGAGACGTTCCAGT
TCCCACTGGACGACGAAACGGAGAGCGACAAAGTGCGCGCCTCACTTGCGCATTACCGTGGTGTTCACGTGATGTTCCCGCTCCGTCTCGACACGGTGAC
GAAGTTGATTGACCAGTTTCGCAATGGCATCCTGCTGCATCGCGTGTACGTGCACCACATCTTGGAAGAGTCTGAAAAGATGTTTCGCATCGTGCACTCG
TCGCCGATGAACGCGATCGAGATCCCTGCGGGCGTGACGCTCATTGTCGTCGGTGATTTGCACGGTCAGTTGGAAGATCTGCTGACGATTCTGGACAAGA
ATGGCGTGCCGAGCGCAAAGATGTGGTACCTCTTCAATGGCGACTTTGTCGACCGCGGCTCGCACGGCGTTGAAGTGATGCTGCTGCTCCTGACATTCAA
GCTGCTATACCCCAATTACGTGTTCCTGAACCGCGGCAACCACGAAGAGCGCATGATCAACGAAGTGTTTGGCTTTGAAGACGAAGTGTACGTCAAGTAC
AACACTGACAATGACGAGACGCTAGGTTGGGAAGGGCTGAGCTCGTCACCAAACTACTCGCCCATGACGCTCTTTCAGATGTTTGAGGACATCTTCGCGC
TGTTCCCGATCTTCTCGCTCGTGAATGAGAGCGTGTTTGTCGTGCATGGAGGGCTGAGCAACCACGACAACGTGCGCATCGAAGAGCTGCTGAAGATCAA
GCACCAGCGCGAGATCCCGACCCAGAGCACGAGTCGCGAGGATGAGCTGTTTACGCATTTGTTGTGGAGCGATCCGCGTGATCGAGACGGATGGAAACCC
TCGGGACGAGGCGCTGGTGTCGAGTTTGGTCCTGACATCACACGCCGATTCTGCCAGCTAAACCACCTGTGTCTCGTGATCCGATCCCACGAATGCCGTG
AAGAAGGGTACGATATCGCGCACGACGGGTTGCTTCTCACTGTGTTTTCAGCGTCGAGTTATTGCGGGTCGCAGACAAACAAGGGTGCGTTTGTGCAGCT
TCAGCTGGTCGAGCACGGAGATGTAAAACCGCACGTAGTTCAGTACTATGCACAGCCATTGCAGAAGTTGCGGGATGCAGGAAAGAACGAGTGGCGGCAG
AAGGCTGTGCGGTTGGAGAGACGCACACTCATGTCACTCGTCGAGCTCATTTGCGAGAAGAAGAGCTCTTTGCTGGCGGCGTTTACGCAGATCGACACAA
AATGCACGGGACGAGTGACACGACTGCAGTGGAAAGCGGTGCTCCAAGCCGCTTTGGGCATCGAAGTGAAATTTCTGTCGTATTTCCACCAGCTTGCGAC
TGAAGAGGACGACTCGCTCGGTGGCATCGACTATAAGAATTTCCTGAACCGGTACACTGTGGAGCTCGGCGGCGGCAACGCAGACTGGAAGAAGCAGGTC
GCACAAGAGATCTGGGCTGGTTTCTCTCGCGCAGTTTCACAGAACGCGCAGCCGAATAGCAGCGACGGCAGCGCCAGTAATGGCGAATTCAAGTTGAAGA
CCTCTCAAGACAAGCTGCAAGCAGCGTTTGATCTTTTCCAGCACACACCACTCGCGAACAATAGCAACAACTATAGGGCAGGCAACGGCGCAGTCCCCGA
GAGCAATCATGCTGGCGGCATCAGTGTCGCATTGCGCCGCAGCAACGAAAGCTTTTTCCACAACGGGCTGGTCACGTACGATGTCTTCCGAACGACGTTG
CAGCGAAGTCTGGTGCTCAATGAGACTTTATCGGAACAGCAGATCTTTGAGCTGATGCAGCACATGGACCAGAACCATGACGGGTTTGTCGACTTTACCG
AGTTTTGCGCGTTCTTCGCCGAAGCGAGTCAGTCGGATTTCCTCCAAGACTTGTTTGAGGGCGAGGACGTGAAGGCGATCGAGTTGCTGCACCAGTTTGG
CTCGCATCTGCAAGATTCGAAGCAGTTCAAGTCGCTCAAGGACGCGTTCTTGACGTTTGACAGCAAGGGCACGTTCCGCTTGGAAGTCGGGGACATTTTC
GAGGCATCTAAGCAAATGAAACTCTCCCCTGCGCTTGATGAGCACGACGCGAAGCTGCTCTACGACTCGATTCTGCGTAGCTACTACGGTGTGACGATGC
GAAAGGAGAAAGAGCAACGCGGTCTCGACTGGGAAGTCTTTGAGGACGTGTTCTCGCCCGATAGTGCGCTGCAGCGCCGATTGCGACTCGAGAGCTGGAA
CGCGTCGACCACCAACTTATCGGCTTTGATCGACAATACAAACTTGACGGCAGACGACGAGAACGGTGCAGAGGGCAGTCCACTTGGAGGTGCCGGCACG
ACGGCGAGACGGAACACGTGGGCTGAGAATCTGGTCGACAGCGCCAAGCACTCGCTGCACGAGCAACGACTGTACCTCAAGTTGCTCTTCCGCATGCTTG
ACCGCAAGCGCATGGGGTACGTCGCAAAGCACAAGTTCATCGCCGTGATGAAGGTGATCAACGACCAGCACGGCTCGCTACTGGACCAGGCGGAGCTCGA
GCAGCTCGCAGAATCGTTCGCTCACCGTCCACCCGTGAAGAAGACAGCGAACAAGGTGAAGAACAGCAATGGGAATGGCAACGACGCGGAAGAGCCAGAA
GAACAAGCAGTAGAAGAGCAGCAGTTTGTGGCGTATCCGCTCTTCCTGCGCAGTCTGCGCGTGATCGACTCCAAGTGTAAATGCTGTTGATTTTAAGTTA
TAGAGTATCCCTTTTACCCTGTCCTTCTCCATTCTTGGCTTGGAAATCGTCGTAGTTAGAAGAAGATTTGCGAAGGGGCACCGAGCATTTGAGGGTCCGT
CCAGTCTAGTAGGCATACGACCGCGGGCATTGAACATTTTAGAGGCAAAGAGAGTGTCACGCAAACGATGAGTGAGCCAGCAGCAGCACCAGCGAACGTC
GATGACAAGCAACAGCAGTCAGCAAGCGAAGATGATGTGGAGCAGCAGCTCAGCGCCACGGCCACGAAGAGCAAGCTCGACAAGCTCATGACCGACTTTG
CAACCTTTGACGATGTCATGCGCATCGGCACGCGGGTACGTATGTACACATGCATTGCTCTCTTAGAGCTGCCATGATCGTTGGCCGTTTTGAGCTGATC
TTTAGATGCATTGGCTTGTTTCATATAGCAACGCAAAGAGCGCGATGAGTTCCGCTTGGCGGAGATGAAGCAGGAAATGAGTTGGCTCGAGAAGAAGCTC
GAGGCGGAGATCAAGAAGCGCGTCGAGATGAACAAGTCGCTACAGAACTACTGCGACGAGCAGGTGGCGCAGATGACCGTGAGCTTTGAGCAATTGTTGA
GTGACCGTGCGCAGCAAGTGCAAACCCGACTCGATGGGTTGGCAAACGAGATCAGCGACATGCAGAACCTCGTCGCGCAGGAGAAAGTCGAGATCCCGCG
CATGATCGAGAACAAGACGAACGAGCTCACGCAGAAGCTCATCGTGTTTATGGACGCGTTCGAAGAGGAGCGCAAGCGCCGCGTGAGCCAGGAAGAGATG
ATCCTCAAGCGCCTGAGCGATCACGAGCACGTGACCGCCGAGACCTTTGAGCGCGAGCGGGTGCGTGAATGCGACGACTGCACAGTATGCTATACCTGTC
CAGCGATCCTGACGTGCTGTTTGTTGGTGCTCTGTAGCGAGACCGGGAGCTCAAGTACTTGGAGCTCAAGAATGCACTGGACGCGTACACTTCTAACCGG
ATACGCGGCGACGAGCGCTTCCAGTCGTTCGCGCAGGAAGAGATTGCCAAGATTCAGAATGCGCTCGTGGCAGAGGCGCAGGTTCGTAGCCCATCATGTA
TTTTGTGTGGGTGGGTGGGTCTGATGCCTTGGTACTCACCCGACTCTGTGCGTGATCCTTTTTCAAGTCTCGAGAGCGCGAGGACGACGAGATCATCGAA
GCGCTCAACCGCTACACGGCCAAGCTCCAGGACAGTCTCAAGGTCATCACCAGTCCCGATGCGT