Description :
From Genome Similarity Track
Location :
Scaffold_536:7024- 9927
Sequence
2903 bases(100 bases per row)
TCACTGGAAGAAGCCCCGTACTGGTAGTACGGCCTATGGCGACCAACGTAGAACGTAGGATGCGTGCGCATCTTACGTGGCAGTTCAATCGTTTATGTTT
TGCCTAGGCGGCGCAGCACACAAAAATGGACCGATGAACTTGGGTAGTATTGTTACTACCCACGTTATTCACAATGAGTCAAGGTAGGTTTACCGTAGAT
AGTAGGAATAAGTCGCCCTCATTGTAAAAAAGAACATTTGCCCTTCCATTCTTGTCAGCGGGTCGTTTTTGACGATCTACCACCTCTGCGATAGAGTCTT
GTACGAAACGGACAACCGTTTCGTGATCCAGTATGAATTCATCTTATGACTCGCTGTCTTTAGCTATAGTTCTCTGGGAGTGTACTGCAGCAAGATCAAT
TGTCGCCTCTATGAGTGCGTCCTTGGACGCACTAGGCGTTATTCTGATTTGATCAGTATCATGGTTATTGAGAGCATCCTCGCTCATATTTTCCTCTTCT
TCACCGAAGTTGATATGATTGAGATAGGCGTCTACTCGGTGACCGCATTGTCAGCACGTGACGGGTGAGAGCCACATTTGCGTTCGCTCAGATGAGTCCC
TCTCCCCCTTAAACAAGATTTACACTTTAGAAAGGTGTGAAAAACGAAAAACGACGTGTGCGTCGTTGACACGTGTACCGAGTTGTTGATCTTGAATTTT
ACCATCGGCAAGAACTGTCCTCGATTCGCAAAAGAATGGACGTACCCTCGAAGGATCTCTCTGAGGACAAGATTGGAGCGTTCTGTCTGGCCATCTGTTT
TAGGGTGATCAGATGTGGACATCTTTAAGCGCGTTCCGAACATGGAACGTCAGAACTCAGCTGCGAACACAGGTCCCGATACACGAGTTCACAAGTCAAC
CCATGAAGGCGAATGACCGTGTCGATAAAGGCACGAGCACAAGCCGATGTGTTGATAGATTTATGTACAGCAACTAGACGTACCATCTTACTAATTTCTG
TCAGCGAACACCAAGAATATCAGTATTCGTGTGGGGATTTGCAGGGAATCCAAAGACGAAGTCCATTGAAACTAAATCCGAGAACTCTGCCGGGACGGGC
AGAGGCTGCAACGGGGCACGCAGGGAAGGACTAGAATTCACTGACCCGAATGTACTTGCGCACGAACTGATACCGGCGAGGACAATAATATTAGTGGCTC
ACGGTGAGATATGTTTTCTCACGACCACAATGTCTACCAACAGGTGCGTCAAGGTGCTCATACATGATAGAAGTCGCAGATCACCAAAATTTGGTGGGGC
GAAACGAGTCGTGTCGCCACCAAAAGCATAATATTGGAGTAAGCCATTGCGAACTGTACATCTATCCGTACAGGATCGATTTACAGGCGACAACGTTTTA
GTTTTTCCTCGAATGATCGCGAGAGATGATGCATCAAACATACCATCTTCGGATCACACGCCTTTCTTTTATCGTCCAATAAGGTTGAAAAAGGGGCAAT
AGAAGTTAATACCGCTACAATGGTCGGACCAGTGTCGGGTTGCGCAGCCGATTCAGAATCGGGCCGGTGCGATATTGCGTCAGCGACGACATTAAGGCTT
CCTGGCTTATACTGGACGGAAAAGTTATACTCCGCGAAGAATGACAGCCACCTCGTCATCCGCTGCAAGAGGTGTAGGCTGTTTACGCCCGTGCGTAAGG
ACGCATGATCCGTATCAACGATAAGGGTCTATCGCCTAGCAGATAGACTCTGAATTTCGCCAAAGCGTACTTCATGGCAAAGTTTTCTTTGTCATGGACG
GGGTAGTTGCGCTCTTCTGGTTGCAGCTGGCGTGACGTATAACAGACGACACGCTCCGCAACGTCTGCATCGTACTGCATTAATGCACAGCCGATTGCAA
AATCACTGTCATCAAAGACCACATGAAATGGCCTGTCTTGGTCTGCAATTGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTCGAAGGGGCG
CGGGCAATCAGCACTCCATTCCCACTTCTCGTTCTTTTTCAATAAACGAGAGTGATGAACAGTCATCTCGGCGTAATTATGCAAGTATTTGCGCAAACAC
GCCGCTAGACCAAGGAACTTTCGAAGTCCTTATATGTCGGTAGGCACCGGCCAGTCAGTGATTGCCTTGATCTTTTCCGGATCGGGCGGGAAGCCGTGCT
TACCCACGATGCATACAAGCAGTGGTATTTCGCTAGCAACAAATAGGCACTTCTTGAGGTTGGCATACAACTGACGCTCACGCATCAGTGTAAGAACCTT
TCGGACATGGAGTCGGTGGACTTCCAGATCCGTCTGTCCATCTTAAGCCCGGCTATGAACTAACACGTCATCGAAATAGCTAGGTGCGAATTCTTGCACA
GATCTCAACAGATTCGTAACGCATCTGCTGAACGTAGCAGGGGAATTACTCATCCCTCGTGGCATTACTATCCACTCCCGAAGCATACCGCTTCGGGAGC
TCACTGCAGTATAGGTGATGTCCCTTTCACGCATAAAAATATGATAGAACCCGTCCATCAGATCCATCGATGAAAAGATGATACTCCTTGCCATACCATC
TATAATGACATCGTATCTTGATATCGGCGTTTGAGCCGGTACAGTTGCAGCATTCAACTTGTTGAAGGCATGTACTTTTCCGCCATCCTCCTGTGGCTTT
TCGCGCACAGAAGGTCGGAGAGCTATGTGGGGAAGTAGATTCCCTCACATAGACGGCTGCTAAGTGATCTGCAGAGATTTTGTCGATCGCTAGTACTTGT
TTACGAGGCAGTGGCCATTGCTTCATGACACAGTACTTCGAAACCGGTTTCAGGTCGATTCCGTGACGAGTACCTTTATCCTTAGGTAATTCTCACGGCA
ATG