Description :
From Genome Similarity Track
Location :
Scaffold_1060:7022- 9394
Transcript NameFunction/comments
g14919.t1XP_009524137.1 hypothetical protein PHYSODRAFT_490055 [Phytophthora sojae

Sequence
2372 bases(100 bases per row)
CGTGGAGTCGTGGAATACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTTCCCGTCGGAAGCAGACCTC
CGAGGATGGGCACCCGAGGACGCTGCTACAGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTTAGCCGTCCAC
CGAACGCCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTCCCTTGCCAGTGACCCCTGGGAGACGCCCCAGAGGGTCGACCGAGGCCGGAATATT
TTCGGCCCAAGGTGCGACGTCGACATATTTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGCACAGAACGACTGGCGAGAGAGGCCGAGGGT
TATCGAACCGCTCCGACTGCTGGACGAAGCGCAAGTCGGACGCCCAGCCGACGTTACGACCTCCGCGACGACTCATCCGACGAAGATTCGTTCGACGTCG
GAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGTTGAGCGCGGTGGAGAATGACAGTGCGACACCGAGGCTAGAGATCGCCAC
GCACCTCCCGCTCGGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCTTTCATATACGAGATGAAAGGG
ACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTGCCCCGCAAAACGAGGCGCA
CGTGGAAATGGTTGAGCGATGCGTTCATTAAATACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGTTCGGTACTACTCGGCCAAGCGAGAGGAGAAGGA
GCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGCAAAAGACCACGTCGAGCAT
TTCTTGGATTCGTGCGAAGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATATGATCAATGATATTCTTC
GTCGCAGAGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAAAGGTAGCACGCCGACGCGATGGTGGACGCTCCGAGGATCCGCG
GGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGAGAATCGTCGCCGGGATGACCAACAGTATCGA
CCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGCAGACGTGCGTGGAGGTTACCCAGAAACGTACAACG
GCGGATATGATGACACCGAGGATTACGGACCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACTCGGACGACGGATACGCGTCGACCGA
GGACCGAGGCCACGTGGCTGCTTCAAACGACACTGAACGTCGCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAAGTAAC
GGTCAGCGGCCGTATGACCGAGATGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCGCCTGCGGAGGACTCACCC
ATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACTCACGAATCTCCTCCGAGC
TAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAA
TCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGTATTCGCAGGTGTGAGCAAACGGCCTGATGACTTGAATATGGAATATGT
GAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAGACGAAGTGGAGCTAACCGACGCT
TCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACAATTAAACTGTTATCTGGCGAGAGAATGGGGTGGTGGTCATCCCAGC
GCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGGAGCGAATGTCAGTGTGAT
TTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGG