Description :
From Genome Similarity Track
Location :
Scaffold_24:70210- 107222
Transcript NameFunction/comments
Phyta_totarag1333hypothetical protein
Phyta_totarag1334hypothetical protein PHYSODRAFT_505814
Phyta_totarag1335hypothetical protein
Phyta_totarag1336hypothetical protein PHYSODRAFT_508027
Phyta_totarag1337tryptophan synthase, putative
Phyta_totarag1338hypothetical protein
Phyta_totarag1339DNA repair and recombination protein RAD54
Phyta_totarag1340conserved hypothetical protein
Phyta_totarag1341kinesin-like protein
Phyta_totarag1342hypothetical protein
Phyta_totarag1343hypothetical protein PHYSODRAFT_560612
Phyta_totarag1344hypothetical protein PHYSODRAFT_560612
Phyta_totarag1345hypothetical protein PHYSODRAFT_354854
Phyta_totarag1346peptidyl-prolyl cis-trans isomerase, mitochondrial precursor

Sequence
37012 bases(100 bases per row)
TTAAATGTCCACCTGGTCCTCATGGTTGCTTGGATGATACTGCGCATTGGAAAAATCGGGCGATGATACGACCATGGGCGATTCGAAGCCAAAGCTACCG
TGAAGAGATGGCGGCATTGACTTCATGCCCGGAGGCAACATCGGCATTGGGTTGAAGTAGTATCGCGATGGTGGAGGGCCTGCAGGAGGCGGCAGGAACT
GGGGCGCATGGAACATGGAGTACGCATCGCCGTTTCCAGGTGAAAAGTACCGCACCACTTCCTTGGGTGCCGTTCTCCACAGAGTCGACTCGTTCCAGGA
AAGATTGGCGCCGGCATCTGGGAGCTCGCACTGCCGTGAAAAGTCCCAGCCGAAGAgagacgacgtggacgcgTAGACCTGTTGCAGCTGCCACTCCAAT
TCcgcgtcatcttcacggcGACGTTGCTTCCTCTTCCACCGCTGGTGTGCGCTTCTATCGTCAatttcatcttctccaccagacAATTCTCCATCGATAC
TTCGGTTGTCGAAGACACTACCCGCGTCACTATCAACATCCTCCCACGGAACGCTGACAACGTACTCATCAAACTTCCGCTTGCCTGCAAATGGAGTCCG
CGCATCAAAGTCTTCAGTAGTTGGTATGCTTTCCTGGGGCTGGAATACGAGCGCGTTGGGATTAAGGCTCGACAACTTCCTCGTAGGCGTTTCCACTTCT
GATGGTATGGCTTCGTCTACATCGAGCGTGACTTCATCGATGGACTCGGTTGACAAAATAGGCTGACATTCGCTATCTACTGCGATGGACAGGGGTTCAG
GCATTGGTTCAGAGACTGGTTCCATCTCCATAGCGTCGTCACTCCATGGTGCAGTTGGATCATTCCTTTCCAGTTGactatcagcagcagcagcagcagc
atcacccCTACTCTGGGACTTAACAGTCTCGAATATACCGGTCTGCTGTACAGCTTTAGCCGCATTCGTtgttgatttttttttttttttcttcttgctc
ttcttcttgccgtgaGAGGTTGAATGGCTTGTTGACGAGCTTTTATCCTCTAGAGACACTTCCAGCAGTAGTTGCTCCATTTGTTGGGCTGCCTCTTTCT
CCAAGTGACTGACGTAACTTCGTAAAACGAGCTGAAACGAAGAACACAACCAGCATACTACCGTTAGTGCCATCATTGAGGATAGTCAGCAGGCGAATCG
AATGAATCTtacctgctccaccagcatcgcGATCAGGCGCTGGTAGTTTGCCCATGTGTTGATAGTCTCACTTTCCGTCACGAAgagcttgttgaagttg
ctctCCGTAAGCACATGAATCGAAGTCAGGAATCCTGCCAATACGTCTCCTACCAGCGTGAACAGCCGATCCGTGCCCTCAGCCAGCTCGGTTTTCACCG
TCAGAATGCCTACATCACACCGAAAAGAGTGTAAGCAAAGTACCATCAGTGTCAAAGGTTACCACCACAGTCATAACCTACGTACCTGTGCCTATATCCA
TGAACTCCATCGCTTCAAGGAGCTcgtacgtcttctccgtAGAGGTGTCTATTGTTGCACGCGTTGACGGCAGCGTTGCTGCGCACTCTTGGACCGCCGG
CGCGGCGGCAGAGGTTGCAGCTTTCGATGCTATTGTCGTTGCGGCCACCGCTGCCACTTTCTTGTTGGCAGTCGCTGTGTCTGTGGCTGTTCGATTCGAC
GTCTTGAGGTGGCGTTGCATCAACCCGACGCACAGCAAACTCAAGTTGAGCTTGTAcagctgcttcaccagtTCTGGCTCGTCCAAAAACAAGATATGCT
GTCGTTCGTTGACGCTGAGCTGCTCCCAATAGTAGCGAACGCTTTTCAGCACCGCGACGCCGTCCTCTCCACCACTGCgtcgcgtcgtcgtcagagGCGT
GGCCAGTGTCATCCAGATGCCAGCCCCTTGTGGTCCACCTCGACTGGCTGACGGTTTTGCTCTCTTCCGTCCACGGGGATTTCCATTGCCACAGATTTTA
TTCACGGGATCCGCTGTGTTGCTGGCATTGGCAACGTCACAGGCGCTCGACGAACGGATGGACAGGTACGAGTTCcacactggagctgcttggacaCAGT
AACAAACAACCACAGCACGAAACGAAACAGTTAGCATTGCACACAATGCGCTTATACCATACCGTCATGGCCACCCACCTTCCGCGGTCGACgcggcctt
cttcacggagGAAATGCTGCTCCGAGATAGCGACGTCATCCTTCTAGCACTTGATTGATGACCCTTCACTAACCAACAATTATTATTGTTTTAGCAAATG
AAATGATTgcatttaaaaaaaacgcAATCATTTCATTTCTTCGTGTGTTTTTACTTTTTAATTCGTCTTTACTGTTTTTACGGCCATTTGCATTTTCTGA
GACCATGGCGGACATCCAGCACAAGCGCATGgcgctcaagctcaagcaggcGTGCGAGGAAACGGCGGCGCAGGCCATCGCGGCCACCACTGCCAGCGGA
CAGGCGAGTCGCATCCACGGCAAGAACCGCAAGTTCAGCAGTCGGAAAGAGGCCATGGCAGCCAAGGCAAGACGGCGCAGAAACTGATAACGGTAACTAT
GCAGTGCATGCAGACATGACTGACCTCGTGCTATTACTTGTCATTGCTTTACTATTGTGGATGCAGATTGCAGCTGCGAAGGCAAAGCGCGACGCGAAAG
AAGCGGGAGATTAAGTAGTAGACGGGCATCTAGTACAGACACTAGGAATAGGCAAGAAGAGCGTCCGTTTTCCATTCCGTTTCGCTGTTTTTCTCGTTGA
CACTGATGTATTTTGAAGTGCAGCTCTGACTGAGCGAGTGAATTGGTGCTCGCGCATTGCAGCTTTTGTCCAGACTTGATTTTGTCGTACTAAGGAGGTG
ACAACGGATGAAGACTGCAGACAAGGCCTGCTCCTGGCCGGTGGTACGAGCACTGGTTGCGAAGAACTGGACGATCAAGAGACGGCATCCGTTCGCGACG
TGGAGTGAAGTTCTCAATCCGTTGTTGTGCATCTTACTCTTTGTAGCGCTGAAGAGATTTGAGCCAGACCTGAACATTCCAGCTGGGTGggccaccagcg
acgccaaTAACTCTGCTCCTGGGTATGGATCTACGTGGAACCTCTACGATACGACGGACTTCAATTCAGCGTTGAGTGGAGGCTTGAGCAGTGCTGGCAT
TGTTGTCCCCGAGGATTCGAATAGTGCGAGCGGAAACAGCAGCTCATCCAATGGAACGCTATCAGCTAGCTCACTGCTAGGGATCCTGAGCAGCAGTCTA
CAAATTCCCAGATTTTACTTCACTGAAACGACGATGCCTGGATTACTGCTACGGCTATCCCTCCAGGCCTTAATGGAAGCCAACAAGCTGGACGAATTAG
GAGAAGACGCGCTGATGGATTGCGCTCTAAAGTTCCTGCTGTTCGGTTACACTGGAGCAGAACGCACCATTTATCACGTCCCCAATGCGTGTAAGGGCAA
AGTTGTGCCGTACAAGATTGCGATTACCCCAGATACGCCATACACGCGAAAGTATGTAGCTGCTGTATTAGAAACTTGGTACCCACGAATTGCTCTAGCA
CCATCCGTGCAAGGGATCTCATTATTGACAATTCCAAGCTTCGCGGATTCGCACATATTTTTCGATGACGAGATGGCTTTAGAAACGTACGTGTCTAGCA
AGGATTACGGCGCTGACATCCAGCATCCAAGAGTTTACGCAGCTATTGCTTTTGAGGAATTTCCGCAAGATACTTCTACTTTTGGTGCCTTGGAAGGACA
TTCTATTGCATATTCTCTGCGATTCAACTCGACCGGGTCTCTCGCTGTGCcgaagaccaagaagccgAGACCCAACACGATGTTAAAGTTTGCACCAGCG
GGAAACACCATGGCGTATGCAACCCTAGGCTTCATGACGCTCCAGACACTGTTGGCGCGCTTTTTCAATTGCATGCCGACATGGGACGTGCAGTCCGAGA
CAACAAATGGAACGTGTCAAGTCAGTCAGGCTGTCATGCCTGCAAACACAGAGAATGATCATCGACTACTAGGACAACTCGAAAATGACATGATCATTGG
CACGGCCTTCACGATGCTAAACTCGGTTAAGGACTTGATCACCAGTATCGTCTCGATGACGCTTCCAAATGTCTCTGTGGATACCATTCCACCACTGAGT
GTGGAAATACTGTTAGTGCCATTGCGTATGGCACCTCAGTCTTTCCATGGTGCAGGTGTCTACGGAAGTCCCACCCAGGCATTTCGTTACACTCCATTTT
TCGACAAGGTAGCCTTGGTATTCCCGATTGGCTTCGTTCTATCCTATCTGTATCTCGTGTCACGTGTCATCGTGTCTTTTCTCATGGAAAAGGAAACGAG
GTCTCGAGAGCTCATGCGGATTCTTGGAGCTCGGGATGGTGAACTATTTGCAGGCTGGGTGCTTGCATACCTGCCAATCTTACTGCTTGGAGCGTTTCTG
CAAACTGTCGGTGCGCACGGGATGCTGTTCCCCAACTCGGATACGAAATTGTTATTCGTATTTTTCTTCACTTTCGCtacaagcagcttcagctacGGCT
TCATGATTAGCACTCTCTTCTCGAGGGCACGTGCCGGGTCGCTAGCAGGCATGGGTCTGTTCTTCATGATGTTTTTCTTATCTTACAGCTTCAGTGACGA
TACCAACGAAGCCAGTCGAACGTGTGCGGGACTACTCCCACCCATTTCCTTGGCACAAGGCATTGGTGTGATCGCGAAGCTGGAATCTTTTGGAATTGGA
GTGAACCACAGCAATGCCAACGAAGAAATCAACAACTTCCGGTTTGCAAACGCGGTTGGCATGCAAATTCTTGACACGGTGCTCTATTTTATACTTGGAA
AATATTTCGAGAAAGTAGTTCCACAGGAATTCGGGGTGGCGGAGAATTGGTATTTTTTCTTGACGAAAGCGTATTGGTGTCCACAGGCTTCAACGCTGGT
GTCAGCTGAAGAGGTAGTGGATAATGAAGAGACTGAGTTAACGACTAAAAATGATGGTGTTGAAACGGTCCGACAAGACCTGGAGATGCAAGAAAGTAAT
GGTCGCGCAGTGGTTATCAGCGGCTTGCGCAAGGAGTTTTCAGTTCCTGGAGGGAACAAAATAGCAGTGCACGGCCTGCATTTGAAGCTCTATGAAGGCC
AGATCACCTGTCTGCTCGGTCACAATGGAGCAGGGAAAACAACTGTAATGTCCATGCTTACTGGTATGACACCACCATCTAGTGGAAATGCTTGGGTCCG
TGGTTATTCTGTTGTCACAGATATGCGGAAAATCCGCATGTCTCTTGGTTATTGCCCCCAGCACAGCGTGCTTTACCCGGACCTGACCGTGAAAGAGCAC
CTGACATTTTACGGGCGTCTCAAAGGTTTTACGGATGCGACTAAACTCGCAGCAGAAGTCACCAAGAAGATCGATGAAGTGGGTTTAGCAGATAAGACCA
ATGTTCGATCACATGCGCTGTCAGGTGGAATGCAGCGAAAACTGTCGCTTGCTATTGCATTTCTGGGCGATAGCACGGTTGTGTTCCTCGATGAACCGAC
AGCAGGCATGGATCCGTACAGTCGTCGGAGTACTTGGGAGCTTATACAGCGCAATCGTTCAGGGCGCGTAGTGATCTTGACAACACATTTCATGGATGAA
GCAGACATACTGGGCGACCGGATTGCCATCATGGCGGAGGGGAGGCTTCAGTGTGTCGGCTCCTCGTTGTTCTTGAAAAAGCGGTTTGGAGTGGGCTATC
TTCTCAGTTTCGTGCGACAGAGTGGCGATGGTAGCTCGGTGTTGCCATCTCAGTCAATTTCACTTGCATCGCTAATTCGACAGCATGTGCCTCAAGCAAG
TGTTGCGTCAGATATTGGAACAGAATTCACTTTTCAGTTGCCCTTCGAGGCGTCTGGTTCCTTTCCAGCATTATTCCGTGAGCTGGAGTCTCATCAAGCA
GAGCTCGGTATTCTTTCTTTTGCCATCTCGGTCACAACACTTGAAGAAATTTTTCTCAAGGTGGCTGAAAGAGGGTGTGCAGGAGCACTGGTCAATGGAG
AGCGTAAAAAACCCAACGCGAATATGAGGGACACTTTGCCAACCCCTGTAGAGCCTTATGAGGCAGCGATTGTCGTGGAATCCGCAAGAATCGACATGAA
AGGGGCTACACCTACGCGAGCAATACGAACATTTATGAACCAGATGAAAGCTTTGCTTCGCAAGCGCGTACAGTGCGTCAAGcgtgacttcaacatgcta
TTTTTCAGTACCATTCTCCCAATtgctgccatcttcatcgGTCTTTCAGCTTTGAAGTTCAGTACGGTGCTTGTAAATGACCCGAAGCTAGAGCTATCCC
CAACCGTGCAGTATCCACTCGCACAGCAAACTCCAGTTCCATTTGGCTGTCCTGGTAACCTCGATCCGACTGGTGATGGAAGTACCGCGTGGTGTTCCGA
GCTTGTTGAGCCAACATACTTTTCAGAAGGCGCTGCATACGAACTCGAGATTGACGCGACTGTGTACAGCGCATCAACAACGCCTACAGTTTTTGGAGTA
ACTTATGATTCGCCTGCTATCGAGCCAAACGATACCAGCGGCTACAGCCTTCGGTTGGCCGAAATGGTCTTTGAGAAGGGATACGGATATGCACCCGACG
ACGATTTGGCTGCTTTGCCAACGCAGGCTGCTGTAGTAGGGCAGTTCGGTGGTTATCTTCTGTACGCGTCAGAAGCTACCAACACATTGAGCTACAACGT
GCTAGCGAACGCATCGTCAACACACGCCGCACCGACATACAAGAATATGATTGATAGTGCTATCCATCGTTTTTTGCTGTCCAAGGCTTCAGGTGAAGCG
AACCCCAACGTGACAATTCGCGTGTCGTCCCACCCGTTGCCGCTCTCTTTCAAAACACGCTCAATCTTCAGCTCATTTCTGAGCTTTCCTGCCGTGATAT
TCATCGTGATTGCCTTCACGTTTATCCCTGCGTCGATGATGCCCTACATCGTCAAAGAGAAGCACCTGGAGCAGAACGCCAAGTACCAGCAATTACTTTC
CGGCATGTCGTGCTTCGCGTACTGGTTGTCGAATTTCGTTTTTGATGTGGCGTTATATCTCGTGccgatggcagcagctctttTGCTTCTTCGTTCTTAC
GGCGTTACGTCGTCACTAACTAGTGGCGAAACTTGCGACTCGTGCACTCAGGACGTACCAGCCGCCATGGTCACCCTTTTCGTATTATTTGGCACTGCAA
TTGCTCCGTGGACGTATTTGCTGTCTCACGTAATGGAAAAACCCAGCGAGTGCTTGCTCTATACAGTCATGatcaacttcttcctgggtcttctactgct
gctgctcagttTCACGATGAACACACTTGATTCAACCCGAGCAGCGAATGAGATTCTAGTTTACATCTGGCGCTGTTCACCGCTGTTTGCCTTTGGAAAT
GGACTCCtcaatgtgctgctggcggaccTACTTGCACTTTTTGGTCTTACGAGCACAACCCATAGTGCTTTTGACGCTGATATCGCCGGCACAGACATTT
GGTACTTACTAATCGAGTGTCCGGTGTTCATCTTGCTCACTGTGGGAATTGATGTTATTCAAGCAGGAACTGTGCGCTGGCGCATTGCCCGGTTCATGGA
CAAGTTCAATGCAGCCACACGCATTTACACGCGTGTACCATGCCACAATGCCAGGCTCCACATTCAGCAAAAATGCGCTGGGGGCAAGGTTATTGACAGT
GAGGTCATTGATGCAGATGTGGCTAGGGAGGCTCGACGTGTACGCGAAAGCTATAACGCGCTTGATACCAGCTCAGAAGTTGTGCAGatcttcgagctcg
agaaaATGTACCCGAACGGAAAACGGGCTGTAAAGTGCCTCTCGTTTGGACTCCAACAAGGGGAATGCTTCGGTTTTCTGGGTGTGAATGGTGCTGGGAA
GACGACGACTATGAAAATTCTCACGGGTGACTTGTTGCCTACGTCAGGTACCGCCACGCTTAACGGGTTCGACATCCGCAAGGAACGAAGCCAAGCACGA
GATTCAATCGGCTATTGCCCACAGTTTGACGCTTTGATTGATTTGCTAACTGTTCGCGAGCACCTTGAGCTCTTCGGCCGGTTAAAGGGGTTCGCGACAC
CTGACAGACTTGAGAAAGAGGTGAATCGCTTGCTGAACAAACTTCAGATCCAAAGTTTTGCCAACAAACTCGCAGGTAGCTTGAGTGGCGGCAACAAGCG
TAAATTGTCGCTGGCGATCGCGATGATAGGGGAGCCAAGCGTTCTAGTGCTAGACGAACCGTCCACTGGTGTTGATCCGTTCTCACGCCGCCTGCTCTGG
GACGTCATTTTGGAGGCATCGGTGAAATCTCGGCGGTCCACTGTCATGTTGACAACGCATTCTATGGAGGAGTGCGAAGCTCTCTGCAGCAAGGCTGGGA
TCATGGTAGACGGTGGTCTGCGCTGCTTTGGCAGCATTCCGCACTTGAAAGCGCGCTTCGGCGATGGGTTCATGTTGGAATGCAAGCTAGAAGCGCCCCC
ATCGCACGCAGTCTCAGACTTGGTACATCTAGTTTGCGACCACCTTCAGACTGCTCGCACCGAAGAAGCTGGAATTCAGATCACCGCTTCACAAATTGCA
GGAGTTTGTACAGCTCTTCGCAAGGCGGAGCGCGCAGaagtagttgctgctgctttgtcGGCTCAGCTGGAACGAGACAACGGTGCTGTCGACGTTGCAT
CCTTTAGCAATTGGTGGCTATCGGAGGATAGCGTCGAGCGCCTGAATAAATTCCTTCAAACCCACTTCAGTGGCGTCGCTCTCATCGAGCGTCAAGCCGA
TTTCTGCCGTTACGAAGTGTCCGGTATTTCCCGTCGGAATGACGCAGCAAGTAGCGAGCCGAGCTACGATTCAACTCAAGCCCACGAGCAGATAGCCACT
ACACTATCGCGCATGTTCGAGGTCGTCGAAGACGCCAAGAGGCAGTTGGGTGTCAAGGAGTATAGCCTGTCCCAGACAAGTCTGGAGCAGATCTTCAACT
CCTTTGCTCGCCGTCGCGAGGGAGCTGGCCTGGATAGATCGACGCACATATCCGAGTAGATGACATCCAACTTCAAAGACTCAATTCCAGTCGCGCACGA
CGCATCCCGAGATGGTGACGCTGAAGTGAGGTGAGTACTGTAGTTCTGTGGAGGCACCGCAACTTGCCTTGGACGCCGATGCCATGAGTTAGGCGCTCTG
CAAgacgtgtacatgtactgtagtgaAAATTGCAGACTGCAACATCAATGCGGCGACAAGTGACCTGGATTTCCAGGGACCGTCGAGTCGCGCGCGTACA
AACAGTAAAAGAGCTTGCTCTGTCCGCGCTCTGGCCGGTGTAGTGCACGCACGATCGCCATTACCGCGCGAAGGAGGCGGCACGAACTTCCGACACCTCG
AACAACAACAGAGTATTAACCCATACCGTTTCATAACCTTCATCTACAGACCGCAGCGCATTAGGTGGTGAGCGCCCGCCCTGCGTACTGGCAGCGTTCT
CGGTTCATGTAgctggcagcaacttgctgacCCGTTTCATCAGGACGACAAGGCCAATAACTCAGGACGCTTTCATTGGCAGAAATGCCCCGCCGTTTAC
AGCAAACCGCCTGTACGAATCAGTCGCTgactctctctctctcatGCCATTCACCGATTTGCGTTCGACGGAGTCTGTCAACCCCCTTTGAATTCAAACA
GCAAAAGTCGAAATGGTTCGCGTGCTCGCACtctccactgccgctgccgtGGCCGCGCTGGCGTCCTCgacgtcggcgctggacCAGAAGCTCTACGGCC
TCAACTACGACCTGCGTCAAGGTCCGGACTGGGACCCCAGCAAGTGCAAGTCCTCGGACGCCATCGCGGCTGACCTCAAGATCCTGAGCACCATCACGTC
CAATGTGCGCACCTACAGTCTGTCGGACTGCGACGTGTCGGGTGTGCTCACGGCCGCCAAGGACCTGTCTCTCACCGTGTGGCTCGGCGTCTGGGTGTCC
GAGGACTCGAAGGTGTACGACGCCGAGGTGAAGGCCTTCAAGGAGCTCATCAGCGCCGGCatcatcgacagcaacgtcgtcGGCATCAACGTAGGCAGCG
AGGCCGTCTACCGTGAAGACATCACGGCCGAACAGGCCATCAAGTACGTGACCGACTTCAAGAAGGTCATGGCGGACAACGACATCAGCGTGCCCGTCAG
CATCACGGACATCATCGACACGTTCGTGCAGTACCCGGAAATGCTCAAGGCCGGCGACATTGTGACCATCAACCAGTTCCCCTTCTGggagaagatcgag
gcggaCAAGGCCGTGGCTCAGTTCAACAAGCGCATTCAGCctctgctgaagatggctgGTGACATGGAAGTCATCATCAGTGAGACGGGCTGGCCTACGG
GCGGCACGGCCACGAACGGATCGGTGGCGTCGGAGGAGAATGGTGTCACCTACCTGAACGACTTCTACCAGCTCGCGGAGTCCAAGGGCTGGAAGTACTA
CTACTTCGCGGGCTTCGACACGCCCTacaaggaggagcaggcggaCGACACGACCACGGTCGAGTCGCacttcggcatcttcgacGAGACGGGAACCATG
AAGGCGGCGTACGAGGGCCTCACGTTCTCCAAGAATGGAGACTTGTCGACTTCGGGCAGCTCTGCCACGACCACCTCGTCgggctcgtcgtccacgtcgg
tGGGCGCGGGCACTGTCACCCCGGGCAGCGGCACGTCGGACACCAGCCCAGGACctggcaccagcaccggCACCTCGACCAACACCCAGTCGTCCTCGAG
CACCGACACggcctcttcgtccagcatttCGAACCAAGAAAGCGGATCGGCGCAGCTCGTGGCCGCCAGCTTTGCAGCTTGCCTGGGCGTCGTGTCCACC
ATGTTCTGGAGCCTGTAAGCAAGTCTGCAGTAGTTCGCAGGTCTATACCAGTACACACGTGATAATGCACAAAACGCATTTGTTACGGTACTCTCTTGCG
AAATATTATACCAGTACCTATTTTAGATAAAAAAATGAATAGTGTGTGATACATCGATGAAATCAAGGCGCTGAAATCAAGGTCACATTCGCGGCTGAGT
ATGGAGAGCGCCGCTACGCAGGCGAAtggagctggcagcagcgaggcATCGACCGAAGggctgctcgtgctggtgatCGACACCAACCCAGTGCACTGGT
TCGCGCAGGGAGGTGATGCAGCTGATCGTGCCGGCTTTCAGCAACTAATCTCCAGCACACTCGTGTTCGTGAACTCgtacctgctgctgcaccgcagCAA
TCGCATTGTGATCATCGCCGCTCATGCGGGCAAGAGCGCGATGCTGTATCCAAATCCTGAGCAAGACGACACTTCAGGAAGGGCGGAGCAGGCTGCTAAG
GTCAACGCTGGCGTcatgcagcgtctgcaggaacTGAGCGACACCCCGATGGACCCAGCCAAGCCCAACCGAACGGCCATCGCTGCGTCACTATCACGCG
CACTGTGCTGTAAGTTTATGTGTTGTTGATAGAACTGCATTGCAGGGTGCTGAAATTGTGGGTTTATTTGTGTTGGGTATGCATACAGTCATAAATCGTG
CCATTAATGAGAAGCCGGATCTGCGACCACGCATCTTGGTCGTTCAGAAGTCTCCTGACGTGTCGGAGCACTACATTGCCATCATGAATGGCATTTTCTC
ggcccagaagaagaacgtggcAGTGGACGCCTGCATCCTCGCGACAGAGCAGTCGTCGTTCATGCAGCAGGCAGCGTATCTTACGGGTGGCATCTACTAC
AAGCCCAACGACCACAGTGGCATGCTTCAGTATCTGATCTCGATCTACCTGCCGGATCCGTCCatgcgcaagctgctgaagctgccgtcgCAGGACTCGG
TGGACTTCCGTGCGATGTGCTTTTGCCATCGCGAGGTAATCTCCACGGCCTACGTCTGCCCCGTGTGTCTGTCGCTGTTTTGCGAGTTTCGACCCATCTG
CTCCACGTGCGGCATCCGCAGCCACATCCACCCGAAGAAGAATGGCTTGCTTAAGAAGCGTCCGCGCGTGGCTTAATAAAATACTGTTGCAATCAGACAC
AATTATCAATTAGACGTGTGGAGTGCCATTGTTGCACATTGCTCGTCATTCACGTTGCACCTCTTGCGAGCATCACAATCGTCGAATATGATTGGCTGAT
AGGGTTTTGATGGCAAAATCAAGATTATGCGCACTAACTCGTTCTCTGGTTGGACGCAAATGCGTTTCACCTCCTTTTCGACCAGTTACAGCAGTGCAAG
TCTGGGGTGACGTTTTTGCGGGCCGACACTTGAGCGCCATACTCAGAATCTCCACGCAAGTAGCAGACCGAAACAACATGAGCAGGTAGGTTGTGACTCA
CACAACTTCTGAGCGAGCTGCCTCTGCAACTTCGTGTGAGTGTAGAGAAGATTCTAACTGATTACATCGACGTGATCATTACAGACCGACGATCGCAGAG
GCTATCGCCGAGCGCAAGGCCAACAACACGGCGGCCTTCATCACCTTCGTGCCCTGCGGcttcaagaccaaggccGACACGGTGGACATCCTGCTGGGAC
TGCAGCGCGGAGGCGCCAATATCATCGAGGTGGGCATCCCGTACTCGGATCCGCAGGCCGATGGCCCGACCATCCAGCGTGCACACCAGGTGGGTGTGGA
CCAGGGCATCACGTTGCACGACGTGTTGGCCACGGTGAGCGAGGCGCGTGCCAAGGGTCTCACCACCCCCGTGGTGCTCATGGGCTACTACAACAACATC
CTACAGTACGGGGAGGACAAGATATGCCCTGATGCCCAGAAAGGTGCGAACACAATTGAGATTGGGAGAGAAACTGTTGTGTTGCTCTGTGGGGCAGATA
ACTAATTGCGCTCTTATTTCCTTGCCGTGTTGATATGTTCAGCTGGTGTGGATGGATTCATTATTGTGGACCTACCGCCTGAGGAGGCCAAATCGCtcag
tgacgacgctgccaagCACGGTCTTGCCTACGTCCCACTGGTGTCCCCCACGACAACGGAGGAGCGCATGAAGCTCATCGACTCTGTGGCGCATGGCTTC
GTGTACTGTGTGAGTCTCACTGGTGTCACGGGCGCCCGTAACGAGCTACCGCCGAACCTCGACGCCTTCATGGCCAAGAGTAAGTTGCCGTTTGCACTTC
TTTGCTAGGGTACCGGGTTGGCGATATGTAGTGCGATTGTATTCTGACGTGACCGAATGTGCTTTGAtgtgctgcagttcgtgcgAATGTGAAGCACCCG
TTGGCGCTGGGCTTCGGTCTGTCGACCCGCCAGCACTTCGTACAGGCCAGTGCGCTCGCAGACGGTGTCGTGATCGGCTCCAAGATTGTCAAGATCATTG
AGGACGCTCCTGACACAGCTACTCGCGCTGCCAACGTGGAGGCGTTTGCCAAGAGCATCGTCAATCCCTAATCTGGTCTCGCCAGTAGAGACGCGACTAG
GACTGTCGTTTTACAGCTAGCGCGCGTCGTGCACGCACTACTCCTTCAATATAGCCTTCGTACCTGTCAGATAAGTTTCTGTTGGACTTGTGGACTTTAT
GAAAACTTGTTGTCTGTAGCTCAGATGGCTACAGTGGGACAGCTTTCTGGCGCATTTGGTTGGCGTGAGTTCGAGTCCCATCGAGGTGATAATTCGTCAA
TTCGTAATTAGGATAGTAGTATAGAAATCGTAGCATACTTCGAAGCCCGGTGTGTCTGTGCCATTAGACTATGGATCGGGTCAATATGTGTGCGATAGAA
ACAATAGCGTGTCAGGGTGTCAGTACTGGGTGATTGGCCAAAAGTGCAAATTAGTCTCAGAATCTGCCAATCGACATGCAAACATCTTTTTGGCGAAGAG
GCGCGAGCAGCATCAACTTGTGTCACAAGAGGTGTCGACCatggacgcgctggaggccATGAAGGACAAGGGCAACGcgctcttccagcagcaacgcttT
ACCGAAGCCGTTCAAGTTTACACCTCCGTcctcgagaagctgcgggACTCTCACGTAGCGGCCGTTCGACTCGAAGGTGCGGTGCGACTCAATCGCGCGT
GGGCGTGGATCCAGATGCCTGGTagcgagagcagcgagtCCGCACTGGTTGCGGCTGAGCAAGACTGCAGCGCTGTGATTGGGAATGACCCAGCCTGCGT
AAAAGCTTTTTATCGTCGAGCGCTGGCGCGAGAGCGTAGAGGCCACTGGAAGGTAGAAATGACAGCGGTGCTATGGTTTGACTTTGACAATTGCTGACCG
AGTTCGAGTTTGCTTGTGTGCCCCTGTAGTTAGCGATGGAGGATGCAGCTGTGATGAAGCGACTCGAGCCGGCTAATCCATCCGTTGGCCCGTTGCTGGa
aaggctgcagcagcactgtcAGGATGAGGAAGACCTGCCACAACAACTACAACAGTGCACAATTAAAAGCGACGGCATCATCAACACTTCGACTGATACC
ACGATAATTGCCCTTGGTGAAGCGGCAGAAGATGCGTGGCGTGCACTGCAAACCACTGAAATGAGGCTCAAGAAGATGTATCAGACTTCGTCGATGGCAC
GGCGCAATCCAAAGAGATCCCAGAAAGAAAAGAAAGGATCTCAATGTGGCCTCGCCACGAAAGGAGAAATCTCGCATAAGACGGACGATCTATGGGAGTC
GCTGAGGCGGGAGGAGATCACAACGGTCGCTAAAGCATTTCCTCGGTTGAAGAAGGGTGTTACCGAATAGTCTGTCATCTCCAATTTTTGATGGCGACCC
ACCAGCAAGCATTGCTGTGCTTATCGTAGATTGGATGCCCATAGAATAATGAAAGAAGATCACATGTTCTATTACCTTATTCCTACcagtcttcatcgtc
gtcgtcacccaGGTCAATGGTTTGAGGGCGAGATCGTCGATAGCGAAGGCcacagcttgagcagttgACGGTGGTTGCTGGGTTGATTAACGTGCATCGT
GAACAGCTCCACGCAGATAGAGCCTCGTTCTCTTtgtgctcttcgtccgtATCTACAGCCTGCTCACGAGCTGGGCGCTGATCACTGAGGACATTTTCAA
CGATggcatcctcgtcgtcggaatCTGAGAAGTCGCTcattttctgcttcttcggtGACCATGAGCCTGCGTCAACTTCAGGCGCAAATGACACCCTTCT
CTTTGATTTAGAAGGCGCCGTAGCTGGTCCAGATTGGACCGGAGCAGAGTGTGACGATGCCTCCAGCAACGTAGTCGACAGTGTGGGACGCCGGATTGGT
GGTTTTGGAGTACACGAAATATCGACTTCAGAGGCCTCCGAGCTGCGCCTTGGTGCCGAAAGAAACGCATCTTCACCTTCGCTCTCTGATTCACTCTCGC
CAAGGACTTCGTCGTTTTCGTTCATTTCATCGCTACTGCTTGAATAATCGACCTCCGATTCGTCCGATTCGTCAATACCCTTGCCTTTCTTCGGTTTGGA
GCGTTTGGACTTGTTTTCCTCCTCAGCACGCTGTTTGTTGGTGGCTTCAATGATTTCCAGAcgtttgcgcttgcgctcctcaTCACGCTGAATTTCcttt
tcttcattttcagctTGGTGCTCCTGAAGCAACTCCCAGTCAATGCGACAACTGAAAGCAAAACTCACCAGGTCGTTTTGGACTTGCTGGAGGGCTGCAT
GcatcacttcgtcgtcgacagaAGCGTAGGAGCGGTGGTGACCCCAACTGTTCAAATCTTCTTCCGGTGGCATGCCTATTTGCGGGTGGTAGCCCTTGTC
TGTGTCCTCCTCATCACTTGTTGTGTCTCTTACAGGTGAAGTTTCACTTCCAGTCTCCTTTCCACtttcatcatcgtcatctaTCGTAATTACTGATGGA
GTGTCCTTAACACCATCATTGCCAGCATCTCTCCATTGGCAACGATCGCATTTCAGTTGATCGTGAGTATCGGACATGGTGTTTTTCCGGAACACGAATA
GCCGCTTCAGATCCTTCGAAGACAGCGAGTTAACCTCCTCTTTATCGTCGACGATGTTTTGAAGACCCTCTTTGGACAGCTGCCGTTGGAAGATCTTCTC
TTCGAGTGTTCCCGTCGCTAGGAAACGGTACACATAGCACATCTTCTTCTGACCTTCACGCCACACACGAGCAGCGGCTTGCTTATCTGTCGCAGGATTC
CAATCAGGGTCGAAAAGTACTAACCGGTTCGCGCCAATCAAGTTCAAACCACACCCTCCAGCTTTACTCGACAGCAGGAACGCAAACGAGTTTGTTGTCG
GGTCATTAAACGTGTCGACAAgtttcttccgcttcttggcAGAAGTACTTCCATCCAGACGAACAAATGGCAAATGCCGCTCTTGACAAAGGGTCGATAC
AACATCCAAGGTCTGCGTGTAGTTGGACACGATCACGATCCGGTCCGTTGTTGTCTTCCTCATAGAGAACATTAAGCGATCGAGTAGAAGCATCTTTCCG
GACCATTCTGGATAGCACGTGCGTCCACCAAAgcctcctcgtcgatggCGACCCTCATCGCCTCCACCGTTTCTGGATTCCTTCGCCGCTGCGAAATACT
GCGCGCAGCTGCCAAATCCAGGGAGTTTGGTATTGGTTTTCCCCATTTCATCGAAAATGAGCAGAGGATGGTTGCACAACTTCTTCAGTGCGGTGATTGA
CGACAGGACGTTAACACTCTGTCGTTTCATCATATCACGACAAGCACTGGAAGACAGGAAATGCATGTAGAGCTGTTCCTGCAGTGGTGACAACGGGCAG
CAAATCACCTGCATTAACTTTGGCGGCAGGTGCTTCGCGTTCAGGATGTTGCCTCGGCGCAAAATAAATTGATTCACGATTTCACAAAGCCTTGCCGAGC
ACGACTGCGCCACTCCTCGTTCACGATCCGTAGAGTCCGGTTCTCGTCCAACCAAGATTGGTCCTAGATAATTCTTCCGAAACTCACTTGGGGTGCCAAG
GATGTTCGGGTTGGTGAAGTCCACCATGGCGAAAAACTCCTCCAGATCATTTTGCATCGGTGTACCTGAAAGAAGTACGCGCTTCCGGCACGCCAATGAA
GAGAGCGCTTTGTTGATTTGCGAGTTGGCATTCTTGAGTCGATGTGCTTCATCACAAATCAGTAGTTCGCAGCAAGCTGGTGTATCTACGAACTTCTGCA
CGTGCATACGGAACGTCTCGTACGAAATGATCAGCACCTGGGCAGAGAATCCCGGTCGTGGTCTCTTGCTTCCCTCAATAAACTGGTTGATGCCTTTGAT
CACTGCTTCACGCTTCGCTTCAAACAGGGCAACCGTCTTCACCCGACcgtgcagccacttgatAATCTCATCGTCCCAGTTCTTCACCAAGGACGTCGGA
CACACCACAATGGCTCGATTTACTGTCGGCTGCATGTTCATGCCTGTCTTGAACAGCGTATACATTAACGCGATACTCTGCAGAGTCTTCCCCAGCCCCA
TGTCGTCAGCTAAGATGCATCCTTGTCCGTCGAACCCTCTCACTTGACACACACAGTCGAACATGAACTGCACGCCTTCCCGTTGATGCGGGCGCAAGAA
CTTGCCCACAATCTCGGGCACCACCACTTTGAGCTCGGGGTCTGTCTCGCTCTGCCACAACACAAGAGGCGGTGGTGCGTCGGCCACGGGATCTCCAACA
GCAACTGGTTCCTCTGTGGCTGGAGGCTCTGACTCCACGGGcatctcgatctcctccacgtctACTTCAACTGGCGGCAGGTCGTGCCGCACCATGGGCT
TCAACACGGCAGAGCCCCAGCGACGTCGCATGCCCAGTGTCTTGATGTGCAACAAGCGGTTGCTCTCCTGTGTGCGGCCGCCCTCTCCACACGGAGATTT
GAATTGACGCCGCACGTGTTGCGCGCGACGCTCTGGCTCCATCACTAGGAACGACAGGAACGGGAGCCGCTTGACGGACAGCGACGCACCACTGCGCAGT
GCCTGGCGGTTGCTAGcggcatcttcgtcttcgaacGCGTCTGCGTCATCGTCTTGCGGCTGGATACGCGTGGGATTGGGCTTCACGGGCAGCACGAACG
GCTTGAACTGCGCACctccgccgccagcgccagcacgtcGACGTAGCATGCTGGAAGAGTTCAAACTGTGGGAAAGGCGGCAATCACCACAGAAGCATTC
GATTGGACAAAATTCGAGGAAAGACCATCACTCAGATACGTTATGTGATTGTACGTTTTGATTGGATGTAAAACAAGTCGTAATAACTTGCTTAAACCAA
TGGGAGGACAGATAATGACATCCGAAGACGTATTGGCACTCAACGAGTCAAAAATGGTCGCTGGAGTGCAGGTGACGGTGTTCCGGGgtgcgctgctgcg
tcggatACGTACCGCGCCGCCAGCCTATAAATTTTTTGCAACTACTACAGACGGACTCCTCTCAGTTGCCGGTCTTCGCGCTCGCCAGTTCGCAGTATTG
GCGTCGAACGACGCCCAAGTATCTCGCCAGACGGCGTTGCAGCGACTCACCGAAGCTTCCAAGCTGTCGTGGAGACTACGCGCCGCTGTGAAGGATGTGG
AGCAGTCACTACCGTCAGACAGAGGCAAGAGGTTCTACAACCGCCGCTTGATGGAGGCTCTGGAGCAGAGCGACTACAATCGCGCCTGGGCCatcgtgga
gacgctgcatgCACGACATCCGGACAAGGCTGTTCTCTGGCCATACACGTACAATCTACTGCTGCGTCACTgttgcaagcagcagaagacgctgatGAAC
GCGAATATGACGCGTatcttggcgctgctggacgtcaTGGTGGCTCATGGCTGCGCGGATCAGACGAGCTTCCAAGTGGCGATGGCTGCGTGCAGTCGAG
CGAGGCATCTACGCAGTGCAAGACatgtgctggagaagatgcaggaCTCTGGGAAGGAGCCGGATGAGAGGATCTATGGCTTTGTGATCAATTGTTGTGC
GAGGAAGCGAGGGCTCGTGAAGACGGCGGAACGGTGTTTTGAGGAGATGTTGAGTGCAGGAGTGAAGCCGACGGGTTTGGTGGTCAATGCCTTGCTGCGG
GTTTACTCGCGCGATAGTGGACGGTCGAAGGTAATGCTGGATCTTGTGAAGCGTGCGCGTGATGAGTTTGGCTTGGTTCCCAACACTGTCACAACCCGGA
TGATGGAGTATTATCTTCTGTGTGAGGGTAACGTGGATGGCGCTGTGGATTACATGCGTGAAGTTGAGAGTGCTTTCCCGTTTGAAGAGCCCGTAAAGCT
GCCTGTAAAACGCAAAGTGGTGAATGCGCTGATCGATGTTTGTCGTCAACGTGGCGAATGGAAGTCGGCTGAGTACGCGCTTAATCTTGTGAACAGGACC
GATGAAGTAGATGTTTCAGCTACTGATACTAACAGAGATGTGCTGCATACGATTaagctggagcagttcgTTGTGAACCGTGACGCTCTATCTGTGGCGG
TAGTCTGGGCTCTGGATGAACAAAATTGGTCTCAGATGACAAAACCGCATCAAGAAGCATTCCTTCTGAATCGGAACCAGAACGAGAGCTTTGAGCGCGC
CTTGGAGAGAATCCACTTACGTACTACCCCATCAAAGACGAACCGAGCTATTCAAAGGCTATCCCTGAAGCTGGAGGGCAAGCTACGAGTTCTGGATGAA
ATGATTCGTACCAGGAACGCAAGTTCAGCAGACTTCAATGCTGTGCTAGGTGCTTGCGGGAGACAAGGACAACTGACTGATGCAGTGTCTGTCTTCACGA
AGATGAAAAAATACGCAGAGTATTTGCCAGAGTGTGCGCCGACGACTTGGAGCTATAACGCGTTGTTAAACGCCTATGCAGTCCGTGGTGATGTTCATCA
AATGGAATCAATTGTGAACGAGATGGTCGAGAACGACGTGCAGCCTGATCAAGTGACAATGAATACGGTGATTAAGGCGCATATCACAAGTTTAAAAGGT
GGTATTAATGGCAGTTCACAGGCGCGTCTCAACACTGTGATGCAAGCGCTTTCATTCTTTGAGTGGTGCACTGAGGACCAAAAACTCGATTCAGGGGCGG
CTACGTATTACTCTTTGTTTCGATTGTTTGCAACGTACTTGGAGATACCTAGTGAGGGCAACGATAACCctgatgacgatgatgatgggATTGATAACGA
CGGCAAAGATAATGATGAAGAATTCATCTTTGGGCAAGAGGGAGAACTCATGGCATGGATGACAGAGTTTATATCCACCACCTGCCACAACGCCCCTCTT
GCATCGCTGGACACTGGCGTGTTCAATAACGCGTTTGACTATTACCATCGGCTTGGTGATGTGGACGAGTCGTTTGCACTATTTaacttgatgaagaagc
gcgggTTTCAGCCGGATGACACGACTCTCGGGTTGATGTTTGCTACCTGCGCgggccagcagcagtttaGCGTGGGCTTAAACTTTTTAGACCATTTAAT
TACCACCGACGGCTACAAGCCTACCCTGAAGGTACTCAGTGGAGCCATACAACTGTGTGCAAACTCCAAGTACCCAGATGGAGCGTTGGAGCTTTTCCGA
GCCATCGAATCGTCAGGCACATTTTCACCTACAGTAGAAACCTACGAGCCTGTGGTGTTCGCATGTGCACGCGTCGGGAACGTAGCCAGAGCCTGGGAGA
TCGCGAATGAGATGGAAGAAAAACTTGGGAGAGTCTCGGTTAGTATCTACAACCGAATTTTGTTGGCGTGCGTGGAGGCTGCTCTTCCTGGACGCGCCCT
GGAAGTGTTAAGTGTGATCCGGCACAAAGTAGGAGTGTCTCCCGATGTCATTTCTTACAATACGGCGCTGGAAGCTTTCGTGAGAGCTGGGGAGCGGGCT
GCCTGGTGGAGAAAGAACAAACTAAATCGGGAGGATGATGATGGAGATTCAGATtacgatgatgacgaaggtGACCGCGATGACAATGACTATTACAATG
ATGAGGCTGGAGACACGAGTGATGGTGTGAATGAAGGTATCGCTGACGAAGCTGACTCGGAGCAGGCACATACAACGACTGTGGAGACAGCACCATCTCA
GGATTACGAGCTCGAACAGCGCGAGAAAGCTGCATGGGTTCGCGCTAGTATTATAGACCTACTCGAGGAAATGCAGGGAAGCCGAGTGAAACCGGATATG
ACAACGTACGAGCGTGCGATAGCTGCGTGCAGTGTAAATGAGGACTCGGAAGGTGTGATCACCATATTCGACATGCTCATAGATCGCAAGCGCGGCAAGA
ATGGCATTGAGCTGAAAAGTGACCTCGTGACTGAATCTAGTTTTTCAGCCTACCTCATGGTATGCACGTCATGGCAAGACAAAGACCGGGTGATTGAAGC
TCCGACACTTCTTCACAAATGGCACACCGCAACGGGCCAAGTTCCACCAGAATTTGTCGTAACGCAGTTGCTCGACTCTCTGGAAGGTCTGGGCGAATGG
CGCCGAGCTGTTCGGATGCTTCCCGAGTGGCAGACGTTGTTTGGCGTTCCACCCAGCGTTGCTGTGTTCAATCGCGTCATGCAAATGTGCAATCGTGCAG
GAGAATACCAGCTTGTGGCTCCAATATTCGCGACTATGCAGGACGCCACGGTCTACCGCGTTTACCCCGACGCAGAAAGCTTTATTCAACGAATTTACGC
CGAGGAACAGCGCGAGAACTGGGTGACCGCCACTGATTATTTCGTAGAGATGCAAAAGAGATGCCCAAGCGAAGAGATTTcacatcagcagcttcagaag
ATCGCTTTGGGTCGGTACAGATTGCGCCAAAATGAGCATTAATGTTAGCAACTCTCATCGCACGTGAGTACTGCTCTGCTACCTGGGCTTTATTCATCCT
TTGATCATTCTCCACAAAGTTACGAGTGCTCACACTCACATTTGGTTCTCAAGCAGgctctcctcttcgtcgcgaAGCACGGGGATCGAAGACGAAAGCG
ACAAACTGAAGTTGGGGCTACCAGGGAAGCTGCttgaggtggtgctggtactgctgtAACCTTCcccgttgctgctgctgctaggTCGTGCGTAGATAGA
CTTATCCGAGGCGTAGCAATGGAAAAACACCGCGCCAaagacgaggacgagtgCAGCGATCGCAAACACCAGGTCCCACGACCCCGTAGCTTGTAGAATT
GCGCCAGTGACCACATTACCAATGATACCCGGAATGGTTCCAAAGGTGTTGGAGACGCCCATAACATGCGCGGCGTGGTTTGGCGCCACATCGATCATGT
TGACCCAGTATCCAGCCATAGCAGCGCGACTAGTGAACAGCGTCATACACAGTAAGGCCACTGCCATGGGGGCTGACTTCGCGAGgcgcagcgagaagag
gaagaaggcgcaTCCGAGGAACGAAAACGCGTTCATGGTCTGGCGCACATGCAATTCACGGTAACCGCGAGTGACCAACAAATCTCCCAGCCGCccgaac
agcagcgtgcCGGTATAGCCGCACATGTAGGGCAGCGCAGCGGCAAAGCCGCCCCTCTTGGCCAGGTCGAGGTCCAAGACTTGGTTAAAGTACTGCGGGA
TCCAGCCCAGCAGTATGTACCAACTGTAGTTGTAGCACATGTGCGCAACATAGATCGCCCACGCAGGACGCGAGGTCAGCAGCACACGCCAGTTTATCGC
ATGGGTGTCCAGCTCGGCGCGCGAGCTCTGACGTTGGTGAGTGTCTGGGTCGACTGTGCGGTTGCGAATGATGAAACTGCGTTCCTCAGTGGTGATGTGG
GGGTCCTCCTCGGGTCGACTCACTCCCATGATCAAGTACACCACGAcccagatgaagctgagcaCACCGAACACAACGAAAATGCGTTGCCAACCACTGG
CGGCCATAATGGCAGGCGATATGATCAGCGCGGAGATGGTGCCCAGGTCTGAACCACTTGCCACCAACGACACGAGTCGACTCCGTTCCTGCACTGGGTA
CCACGCGCCAGCAATTTGATGCATGCACGGGAACAAGATGCCCTCCCCAAGCCCCATGCCTGCTCTCGTGAAGAACAGACACGTGAGGCATTTAGCCACT
AGCACCGTCGACAGGTCCTGCAATGACAACAACAGAAGAAGAGTCAGAAAATAATTATACTCTTCGCTGCCACAGCGTCAGCCAAATCAATGGCCACGAC
GTACAAACAGCGTCCAGACGACAACTCCAGTGAGCAACACGATTTTGGCGCCAAACTTAGCAGCGAAATACCCTCCCGGGATCTacagcgacagcaaaaa
gaagaccaacaacaTGAGGAGAAGGTAGAGcttcagcgctgctgtgACGCCGAACATACTTGAGTGCACATATAGCCGTAGAAGAATGCGGACAGCACTT
CGCCCTGTTCCTTCTTGTTGGTCACGAATGCCGGCAACGCGATGCCCATGTTAGTTCCTGCTCCAGCCCCCAACGATCAAAGCCAAAATCAGATTCCGTG
ACTTCAAAGAGCTCAGGCGAATTGCTAATTCCTCGCAAGCGCACGTACGGTCAGCGTAGCAGATGGTGGAGACGCAAAGACACAAGAACGCCGTCACATA
GCGTCGCTTGCCTTGCGGCAGCTTCGCCGAGACGCCCCccgcagcgacgacgtcggcCTTCTTCCAGGGTCCCTCCTTGCTTGCCATGATGCTCAAATGG
CCGTTAGGATTGGCGGATCGCGACCGTTACACTCATCAGGTGTTTCTACCAATCACAGTAGGACAagatcacttcaacgtgcagcaCTTCCTCGCGATCT
TTTTCCTCGCACATGGACATCAAAATAAATTGACACACTCGCACCGAGCGGATAAGCTTACATGATGGGACTAACGGAAGTTCGTGGTCTCTCCTAGAGG
CGACTTGGCGCGGTACCGTTTCGGAGCGGCGAGAGCTGACGTTTTGGTTGCCttgcgagctgctgcgcctgcacTGGGCACCTTCATGCTCCTGTGCGGG
TGGACGACCACGGGCTTCTTTCTGTGCAATCCAGACGGTcccgccttcttgatcttggacggGGTATTGTTGGCTACAGTAGCAGTAGTAACAGGCTTGG
TCTCAGTTCGACGTTCCGGACCCTTTGCAGTTGCACTCGATTCGGTAGCTGATGCTGGGCCAGGATTCATAGATTCTTGACTGCTGTTTGACGCAGTGCT
GGCAGTGGCGGTCTTGGTGGTCTCGGTGGTGACTGGAGCATCGCTTTGGGATTGCACGGCGGAGTCTGCGATGGTAGGCGTGACGTCATCATTAGCACTG
GGACTGGCATCGCTCAACCTCCTTCGCTTGTGGCCAGGCTCATTGCTTGGCGAGTTGGCATAGCTGGATGAATTCGCCACGTCGGCCAACTGCTCTGCCG
AAACCTTAGTGGACTCGAAGGAGGGGAATGGTCGGTTATCCTTCTTCGTTGGGGTTGCTCCCGTTCGTGCATTAATCTAGGCAAAAAACAGCAAGTGAAC
CAGTTAGTTACTGCAAGATGCAATACCGTGAAGACAAGTCTTACctttcgcttcttcatgtATGTCTCCATatcttgcagttgctgggTGGACGCTGTGG
TAGCTTCACCAACAATTTCCTTGCCAAGCGCTGATGCTGACTCAATCTTGCCCTGCGTGTTTGAGATTTGAGTTTGGAGTCCTTCTTCCAGTGTCTTGCA
CCCGCCATTCAGAAGTTGTCGGAGCTTTTCATGGTCACCCAGGAACTGCGCCAATTGTTCTTGCCTCTTAGTTGATGCCGCAGCATCATCCTGCGAGTGC
TTCTCCGTTAAAGAAATCACGTCCTCCGTGTGCTTTTTAGCAAGCACAGTAGTCTCGTTGCTCCACGTGGTTTGCAGTCGTCCGTGTACCTGAACCAACT
CCGTTTGCCGCGCGTTGGTATCACCAAGTTGACCTCGCATTTCAGACAAACGCTCGCGGAGTCCAGCTGTCTCACTCTCGCGTTTCGAGTTTTGACTGCT
CATGGCCTGCACGAATCCCTTCATTTCTTGCTCCGTGATGGTCTGTACGTGTGAAAGTTGCTTCTGTTGGTTCTTCGCGTTCTCTTCGATAAGCAGTGCc
tgctcgtcgagcttctgcGATTGGCTTTGGATGCACTTCTCGATGTACTGAGCAAGATGTGCCTTCATGCCATTTAGttcctcttgctgctgggcgtgaC
TATCTTTTAGTGCAGCTGTGATTGCCGCCTTGCTTTCGTCGAGTTCCTTGCCTTGTTTCTCGATCGACATGTCAATTGCCACCTGTAGTTCTAGCAATTT
ATCGCTCTGCTCGGTGAGAAAGCTGCTTAACTCTTCACGGGAACTCTCCAGTGCCGACTGCACGTTTTCCAGGAATGACACACTTCGCGATTTAGACGTG
GACAAGTCTTCCATGATAGCCGTCGCGTGGCTTTTGGACATGTCAACGAacttctcgagctgctgctgcataaCTTCCTGCTGATCTTTCATCGACGTTg
ccacttcttcacgctgtcCACGCTTTTGggcatcatcttcagcgaGTGATTCAGTAGATTGTTTTCTACGAGCTTCGACAAGGCCTTGCAGTGCGTTCAG
ACTCGTGACCAAACCATCCAAGTCTGTTGAATGAGCAttttgcagctcgtgcagaGCGTTCGACACGTCATGAAACGTGCTTTCTTGACTCTCTTTGTGT
TTCGCTAGTCGCTCCAGAAACGAATTAATCTGGGACTGCGATTCACTACGATACGAAGTTGCCAGCTCTGTGTTGGCTTCTTCTGTTCGCTGGGTATTCT
CTACAATCAAGAAGGAACAAACATCAAACATTAGCTAGACAATCACAATACGTCGGAAGCAGTAGAAGGACAATCGTGCGTACCAATCTTCGTCAAAAGC
TGGGCGGCCCGTTTTTCACTGGCATTGTACAACTtcgcagcagtcgctccGTTTGCAAGTAACACTTGCTCGTTGTCCTGAAAGGCTTTCAGCACGGCCT
GTGCTTGTTGCAGTTCCTGATTCGTTTTCTCCAGGGTCTTCTTTGTGGAGGTAAGTTCGGCTTCCGTAGCAGCCAATTTATTGCTCACTTCTTGCTTTGC
AAGTGTCAGTGCTGCTACTTGACCCGCATGCTTTTCAGCAACTTCCTCGAGCTCTTTGCAAGAAGTGCTCCTCGCCTTTAGCATATCCTCTAGCTCTGTC
AGCTGCACACCCTGACCGGCCAGTCGCTCTTGCATGTCAGTAAACTGCTCCAGCGGGAGGTACACGCCGTCTTTCAGTCTAGCAGCACGCAGGGCTGCGC
GGAGCGTCTCGATCTCGCTTCCAAAATCATTCAGCAGTCCCGCCTTGGTCATCTTCTGGTTCAGCTCAGGCTTGTTCTTGATGTGCTTTGCGCGGAACGC
ATACTCCAGCGTACTAAGAGTCTCGTCAAGGCTATCAGCACAAGGAGCTAGTGTTGCAATaatcgtcgtcttcgcccGCCCTCCAAGTGACTCCTGCAGT
AAGCGCGTAAGCTTACTATCGCGGTACGGGACGTGTGGGAGGTTATCAACCAGCGCCGTGATTACACGGCCCAATGTGAGCAAACTCTGGTTAATTGTGC
CTGCCTCGCGCGCTCTGGCATTGCGTGCTCCCGAGCGACCCACACACTCGGATCCTGCAAGATCCACCAGGTTCAGCTGTCCGACACGCAGCAGATCTTC
GCCTGCCGCATTGTGCTCCTTGCTGTGAATCCTAATGGTGAAAATACTATGCGAGCGACTGGAATTCTCGTTCATCAGCGTCTCGGATGTGACGCGGTTC
TTGACGCCAGTATTCACCAGCTCGTACACGTGCTTGGCCGTGGTTGCCGTGACTTCCAGCAAGTTCACGCAGTAGATTCCTCCCCTCTTAGCATCCTCCA
TGAGtctcagcttcttgtctgTGTCAGGGTCCAGTAGATCCTTGAGTTCTTCGTTgtagagctgcaggaaggaCACACGGACGCTAAACTCCTCCCCACT
GGCCTCCAGAGCGTCGAAAATGCAGCGCACGCTGCGTGGGATGATGCCGGCCGTCTCGCTGCCCGGAGACAGATCTCCCTGCATCGTGTACGTCTTGCCC
GTGCCCGTCTGGCCGTAGGCGAACACGGTGCAGTTGTAGCCCGCCAGCGCCTCATCCACCGCCGGCCGCACTACGGAGCTGAACACGTCCTTCTGCGTCG
AGTACTGGCCGAAGACACGGTCGAACGTGTACGTCTTGCGCTTGACCACGGCCACTTCGCTCGAGTTGGGCTTGCACTGCACGACGGCGCCACGTCCCGC
GCTCTTCTCGCGGCTGTTGAGAGGACGACAACGCACTGCCACCTGAACATTTGTGGGCGTCGGAGGCTGCGGCGGAGCGTCGTGgttgctggatgaagag
gacgacgacatgcGACGATGGTCGCTGCTAGACTCTGTCATCCCCGCTTCAGTTTGAACTTTTTCAAAAACTGGCGCGGGTTTGCGCGCTTTTGCGGTGC
CCGGGATTTACATTAAACTTTACACAAATATGTATGTTTTTGAGTCCTATGATTTGTTGAAACATTTCATAATTTCAACCAATTGAAGTGGCAGTGTCAA
AAATGAATCGGTTGTCGAAAAAGCATGTCGAAAACGTCTGACCTGCCGACCAACCAACCCTTTTGAAGTGGCATTTGTACTCAAGTCAATCGCCTACTTG
ACAGCCATGACGCAGCTCAAGGTGagcgagacgctgctggacggacAGAAGCCCTTCGCCGAGTGCGAGTTTGGCCTGGACCGCCGCCTCTCTAAGGCGG
TGGCCAAGATGCGCTTCGTGCACCCCAcgctggtgcaggtgcaCTGTATtccgctggcgctgcagggcAAGGACCTGCTGGTGCGCGCCCGCACGGGCTC
GGGCAAGACGGCGGCTTTCgcgttgccgctgctgcacaagatcctgcagcacaagcaggaCGCACCCGCCAGCGAGCCGGCTGTGCgcgcgctggtgctg
gtgcccaccaaggagctggtggagcagacgCGTCGCCACATGATGGAGCTCATGTACTACTGCCAGGACACGGTGAGTCTGCTGGCTCTGGGCGGCCAGA
GCATGAGCGTGCAGCAGGCACTGCTGCGTGACGCACCCGACGTGCTCGTGGCCACGCCTGGCCGCCTTGTGGCACACCTGGAAGCTGGCAATTTGACGCT
CAAGGACTCGGTGCAGACGGTGGTCATTGATGAAGCCGACCTGGTGCTGTCTTTCGGATACGGTGAAGACATCCGCACCATTTTCAACGCGCTGCCCAAG
GCGTGCCAGACGTTCTGCATGTCGGCGACGTTGAGcccggagctggagaagctcaagcgctcGGTGCTGCACAACCCTGCGGTCGTGAAGCTCGAGGAGG
GAGCGACGGACggaaagctgcagcagttttACCTGCCGGTGAAGGCTGGTGACaaggatctgctgctgtacgcGTTGCTGCGCCTTGGCGTCGTGAGCGG
CAAggtgatcttcttcgtcaactcGACGGATGCGGCGTACCGACTCAAGCTGTTCTTCGAGCAGTTCGTGATCAAGAGCGCGGTACTTAACGCCAAGTTG
CCTCACAACTCGCGCCAGCACATTATTGAGGAGTTCAACCGCGGCCTATTCGACTACCTTATCGCTACGGATGATAGCGTGGATCGGGACGAAGTGggtg
acgaggacgaagacgatgaggaagaggatgaggaggatAGAGAAGGAAAGGATgcggaggaagacgaagaagaggaggaagacgcagAGAAGCCTGATGC
AGAATCTGACGCtgtggaagacgaagataaggaggacgatgatgaggacagcgacaaggaagaggaggaggacagcgagaaggaggacgaagccATGGAT
AGtgacaaggaggaggcatCTGAaaacgacgaagctgatgacgacgatgagaAAAAGACGGTGGGCGCTAAGCGTGGACGTGCTGATGACGAAGGCTACG
GTGTGTCCCGCGGTGTTGACTTCCGTGGAGTTCAATTTGTTATTAACGTGGACTTCCCGAAGAGTGTGCGTGCGTACACTCACCGCATCGGACGTActgc
acgtggtggtgcctcTGGTACGGCGCTGTCTCTGGTGTCCAAGGAAAACCCCAAAGAAGAGCGTGCGCTGAAGCGTGTGCAGGCAAAGCAGCAGGCCGTC
TGCTCCGAGGCAAATGACGTTATTGCCCAGCCCGCTGAACTAGCCTTCGATCTCAAGGAAATCGATTGCTTCCGCTACCGCGTGGAAGATGTTCGTCGTG
CTGTTACGCGTGTGGCCGTACGCGAGGCTCAGCTGGCTGAtgtcaagaaggagatgctcAACTCCGAGCGTCTGGCGGCACACTTCGAGGCGAACCCGCG
TGATCTGAACATGCTTGAGCACGACAAGGTGGTGGGTTCTGCACCAGTGCAGGCTCACCTGGCGACTATCCCGGACTACCTTGTGCCTatcgagctgcag
ccaccggcaccagcacgtaccaagaagaaacacaACAAGCGGCAGCGTCTCGCCGACGGCAAGCGCCGTACGGATAATGACCCATTGCACACGTTCGTGG
CTCCTGATGCCGATGACGACAAGAAACAGACAGTGGAGGATCGTATCAGCTATGGTAACACCGGCGTGGGCAAGAGTACTGCTGGTCGTCAGAAatggaa
gaagcagcaccgcAAGGGCCACTTCAACCCCAAGACgatcgccaagaagaaattcAGGATGAGCAAGGGCGCCACATATTAAGGAGCCTGAACTTTGAAG
GATGGAGCGTCGGTACCAGGTATCACGGAACTTTGATCTTGTTTTGCTTGCCAAatagatacatgtacacgtttTTGCTTCGTTTATGGTGTGCTTCGTC
TTGTGTTTGTCTACTGCAGGTTGCGATCGACTGTCGAAGCGAAAGCCGGTATCGAAATGGGTCGGCTAGTGCCAAAGTAGCGCAAAGCTGCAGGCGGTGA
GTTGCTAGGCGGCACGAACAGCGCGAGACTGTCCAgatctccttcttgctgctgctggacgattTGGAGCCAGAGTTCGTCGCCCGCAAGCTGCACCACC
CGGTCGGCTGGTAGTTGTTCGTCGGGTACATCCACTTCAACTAGCGCAGAATCGGCACGAGGCTGCAGCGCATCGGCCATCATCCGCTTCCGATCGTACG
CGtagtccagcagctgcagactgcgCATGTGCTCGGTGTGCTCACGTTCCACGCGTGCAAGTCTTCTGTGGTCTGCCTGGGTGCTGGCTGTGGCGCGCGC
TTCGAGAATCTCAGGTGGTGCAGGGAAAATGGTGCTCGTAGAAGATGACAACGCGAAAAGAGGCTTGTTGCGGCGCACCACTTCCTCACGGAGTGACCGG
AAGTCGCGCGACAAAAGCAGTTCTTCCTCGGCAAGAGCTTTCATGACACATACCTCCTGTGCCCGTTGTGCGCGAGCATCCTGTTCGATTGCTTGGCAGT
GCGCTTTGTGGAGCTGGTTCCAGTGACGAGTCTGGTCGGTACGAGCTATTTGCATGTCAAGTTCGCTCTCGCGGTGGTTGCGCACTTCCTCGTTGTGCAC
GTGGCGAGATATCATGGCCACACTAGCAGTGAACGCGCGTTCAATCTCTGCGCTTTGCTGTCTTGTCCGTCGAGCCAACGCATCGgtctctttcttcttt
cgacgttgctgcagcttggcgttTTTGAGCTTGGTCACCGCTGCAAGTGTTGCAGAGTCGGGTTTGTTGTGCGAACAGTACTTCGCGTGAAGAAacgctg
gagcagacgcagacgaaTTGAGTGAgggtggtcgtggtggtgggtggCGAGCGTATGCTTCGTACGAAAACGTGCTCGTAGCATCACTTTCGTGTGCGAG
TTGGTCGAATGGTGGTTGATTCCCTTGCGCGGGTGACTGCTGATGATCATATTGCAGTGGTgacagcttcttgagcttcccTTTTCCAGCTTTCATCGCg
cattgctgcttctgccagGTTGAAAGGCTTCGCACATGCTCGATAAGAAATGTCTCGGTAAACCAGAGCTGACACGCTTGAATGAAATCACTGACGGAGA
CTGTAGGCCCTACCATTGCAGAAGCAGTTGAGGGTGGCAACCGCTGCTCCCACCGACGAAAAGCGGCTTCATTCACCTCAAGGCCGTGGAAGTGTAGCAA
CGGCTTTATCTGCACAAGCTTCAAACGCCGACTATGTCGCACCTGCGGATCGAAAGTCACCATGAGTTTTTCGCACGCAGCCATGAATGCCAAGCGACGA
TTGCCAGTGCATTGCGGAGCACTTGCTAACTCACTACCAGGTGATAATGGCAAAGCGGAAGGTGGCAAAGTCGATAGCGACGCAGTTCTAGACGCGGGAC
TTTCGTACGCGATTGGACGCCgatcgagctgcttggcgtgcGGCAGTGGGCGTTGCAGCATTCGTTTCACTAGTTCACGATCGCGTACAATCGCTCCCAG
GGTTTTGATCGCTGCAGTGGAATGGGGCTGGACGAGCGGCACGGTCTGACGGTACAGCTCAAGCATGTTGACGTCACCGTTGCGAGACCTGCTTGAGGAG
TTTTCAAAGCTGCTTTCATCGCCATTATCTGCAgggtcgtcgtcttcatcgtcgtcgactCGAGGCAACTGGAAGGGCAGGAGGTATTCCACTGAGGGAG
ACATTGACTCCATGGGCTTCTTTCTGTATCACGATTTTGGgtgcttccttctcctttcTCCTGTTTGCATGTAGCCATTCTGTCTGAAAATAGTCACGAT
GCGGTGATTGGCTGatcttgttgaagtgaagctacatggatacatttgTATTCTCACTGTAGGCTTGGtggtctacatgtagtctaCCAGTGTCGCGTGT
TCAAATTAGCGGGCGTAATAGAGCTGGGTCGCTTAGCAGGCTGTGGCGGATTCCGTAGCACAAGTACACGATCAGCCCCACACTCAACCAGATGAGCACA
CCGATCCTGCAAGCAATCGATTGGCAGATGCCAAATTAGCAGCAAGATCCTGTTTCACGTGAgtaaaatacatgtaaacgTACCAGCCCTCGCCGGGGAT
ACTCGCCACCATGAATACATTGGCAAGAATCCCGAGGCATGGCACAAGTGGCACTAGTGGGCACTGGAATGATGTTGTCAGGTCACTGGAAAAACGAACA
CAACACGCACTTTAGAATTATACAGCCATCACACAGTAGAACACTACCGGCAGCAACACTGCGCACCTGAGTTTGCCCAATCGATAAATGAACACGAATG
AGGCGATCACCATCATCGCGAACGCGCCTTGAATCGTCCAAGACAGATCGAACACGAAAGACAGCGACAACGCGAAACACGATATCACGTACAGGAGAAc
acggtggacgacgccagcaccGCTGCGGCTCGGGCGCATGCGCAAAAGTAACACGCCAGCATTCACGAAAGTAAAGACTTGAAGTGTTCCACACGAAATC
ACGTTGGCCAGGAAACCCAGTTCGAAGACGAACGCGATGGATGCAACAAGGATACCGGTTAAGATTGTGCTGGCAACAGGCACGTGCGTCCTGTGGTGCA
GCCTGGCGAAGAGTGACGGCAGCAAGCCATCCTTGGCCATCTGATAAAAAATACGAGGTTGGCCCATGAGGCAGGTAAATGCTGCAGTAGTAAGCCCGAA
AATCGAGCCGAACGATACGATACGTCCAGCCCACGGTGCATCATGGAAGATGAACGCATTTACAAGCGGAACTTCGTTGCCCAGGACATCCACGGGTGCC
ATTCCAGTCACAACGAGCGAAACTCCAACGTAGATGGTCACGGAGATCAACAGCGAGCCAATAATTCCCTTGGGCAGCGTGCGCTGGGGTTCGTGCACCT
CCTCTGCAAGACAGGCAACCATATCAAAACCCAAGTACGAGAAAAACACCACGCCAGCACCAGTCACAACACCGTGAACCCCGGCAGGCATAAATGGTTC
CCAGTATGTAGTATCCACTTCAGTGCTTCCgaacaccaccacgaagagcagcaccgagatgttcagcagcgtcacaAACGCATTAAACTTGGCGGATTCC
TGTAAATTGCACATCATAATCCAGCGACCGTATTAGCATAATCAAAAGGAGTTGCTCGCCGACGTctacgttgaagctggaatACGTACGTGAACGCCAG
CAAGCAGGATGAAAGTACAGCAGATCACGAGAAACGCCGCCAAGATACTACACGACACACCGAGAAGCTCTGCATGCACGAGCCACTGTGGGATATGAAG
ACCCAAATGTTGCAGGAACAAGTTCGCATACGAGGCCCAACTCCGAGCGATTCCAGCTGCCAACAACAAAGCAAAACAACATCAGTCTATGTATTTCAAC
AACTAAATGGCCCCAGTCACTGCCCATTTACCTGCCGAGATACCGTATCCCAGTGTCAAATTCCAGCCAACAAGCCACGCCGCCAACTCGCCGAAGGTAA
TGTACACGAACGTGTATGCCGAGCCCGTGACCTTCATCCACACAAAGTTCAGTGTCTCGCACCTCTCATCCGTTCTAAAAGACTGCAACGTACAGGCACA
CGAGCTGCAAACTCCGAGTACGTGAGCGACGTGAAGATGCAGGCGATGCCGCTGACGAGgaacgacagcgagatgCTCGGCCCTGCGATCTGCGCACCCA
CACCCACGAGCGAGTAGACGCCGGCGCCCACCGAGCAGCCCACGCCATAGGCCACCAGATCCACCAGCGTCAGACATTGCTTCAACGAGCTGGGACCGAG
CTCGCAGCGAGACAAAGGCTTCACGCGGCCTGCAGCCTCCAGGAATCGATCCATGGCGAATGGCTGCGCTGGACTTGTCTTCCTTCTGCCTTGCTGCGCA
AATTGAGTCCGACTCAGATGAAACAGCTGCATAATATATTTCAACCAATCGAATGTATATATGCATGGGATTGGCTAAAATAAGTTCGTATCCAAAAAGG
GGGCGTACAGTATTGTGAAATCCCCATACAAAAAGACGAGCGAAGATGGCATCGGTCCCGACGGAAGATGAGCGCACGCAGGTGCTGAACGCGTACAAGG
CCAAGGTCATGGAGCACCGCGAAATGGAGAGCAGGTTCGTCGCTTTCTCTCCATATAAATTTGTCCGTCTAGAACGTGCTAGATGCTGCGTCAACTGTCA
TTTACCGACTGTTTTTACGACGTTTTTCGCTCTAAATCAGAGTGAAGAACATGCGCGAGAACGTTAAGACGCTCGTGAAGGAGTTTAACAAGACGGAGGA
CGACCTCAAGGCTCTGCAGGTGCGGAATTACAATACCCTTTGACGAGTAAGTTTTTACTGACGACGTTTTTCCGCAGAGCGTGGGCCAAATCATCGGCGA
AGTGCTGCGTCAACTGGATGAAGACCGCTTCATTGTGAAGGCATCGAGCGGCCCCCGCTACGTCGTGGGATGCCGCgccaaggtggagaagagcaagctc
AAGTCGGGCACGCGAGTGGCGCTGGACATGACGACGCTCACCATCATGCGCTACCTGCCGCGGGAGGTGGACCCTACGGTGTACCACATGCTGAACGAGG
ACGCCGGCAACGTGTCGTTCTCGAGCATCGGCGGGCTGAACGAGCAGATCCGAGAGCTTCGCGAGGTCATCGAGCTGCCGCTCACCAACCCGGAGCTGTT
CCTGCGTGTCGGTATCAAGCCGCCTAAGGGTGTGCTGCTGTACGGTCCTCCCGGTACGGGCAAGACGCTGTTGGCACGTGCTCTGGCGTGCAACATCAac
gccaccttcttgaaggTTGTGGCAAGTGCCATTGTGGACAAGTACATTGGTGAAAGTGCCCGTGTGATCCGTGAGATGTTCGGATACGCCCGAGACCACC
AGCCGTGCGTCATCTTCATGGATGAGATCGATGCCATTGGTGGAAGCCGTTACTCGGAGGGCACGTCTGCTGATCGCGAAATTCAACGTACGCTGATGGA
GTTGCTGAACCAGCTTGATGGTTTCGACGCTCTGGGACAGGTGAAGATGGTCATGGCTACGAACCGACCGGATATTCTGGATCCCGCACTGCTGCGTCCT
GGCCGTCTTGATCGTAAGATTGAGATCCCGCTGCCCAACGAGGCTTCGCGCATGGATATTCTCAAAATTCACTCTGGCCCCATCACGAAGAAGGGCGAAA
TTGACTACGAGTCGATTGTCAAGCTCACAGACGGCTTCAACGGTGCCGACATGCGCAACGTGTGTACCGAAGCAGGTATGTTCGCTATCCGTGCTGACCG
CGAATACGTTGTGGAGGAGGACTTCATGAAGGCTGCGCGGAAATTggcggagacgaagaagctcgaaTCCAAGATGGATTACAGCAAGGTTTAAATGTGC
TTGCTATTACGCGCTGTGGGCACTTCCATCTGGCGCGGGTGTACGTTTTCCTACTCCGTTCATAATGATTTTCAGAGTTGCAACCAGTTTGAAAGGCTGA
CCGAGTCGAGCAGAAACGAGAAAAGGGGAATGAACGCCGCGTGGTGGGCTGTATCTTGATGTCGAtggcgttgttgttgtgctaTCATATTTGGTGAGAT
GTTGTGCACACGTTTTGCTTAGGTTGATGTTGTTCGCGCCGCAAATAAACCCTTGGGGGTTGCGACATAAATGGTTTGTATTTTGCAATTGCATCAGTGT
TAGTTTGAAGGACCAGCGTCGTGTGCTAAGATGGCGTCGGCAGATGGAGCTGGCATGGAGTGCTGCGAGCTGGTAGGCCTCATCAGTGATGTTGCATACC
AGCGCTGTCGAATTCTGCTCCACGAATTGCGCAAGCTTCACCCGATCTTCGTGTCGCCGCTGGAGGGGATGATGGAGGTCGAATATCTCGAGTATTTGCG
GAACCAGCAAGACAAAATACCCAAGAGCAAGCGCGCAGAATTACTACGAACGACTCGGCCGATCATACTGCTGTTGGATTCTTCAAATGAAATGCtggat
ggagaagacgagctgcttgactTCGCAATGGAGCGGACGCAGCTTTCGAAGAACGAGCTGCtagctgcagctgcgttCGGTGGTGTCCTGGTGGTCGGCA
ACGATAGTGACGGCAATGATACTGCCAGGAAAGAGTATGGTGAGAAACTGGTACTTGCAGAGGAAACGCTGGAGACAATGGCGGAAGAAGCAGCCCAGCA
GGCCTTGACACGCTATCGCGAACTGTCAGGCCACCAATATGCGTTCTTGGTCTTTGAGGTGGATAGTGTGGCGCTTCCTCGAGTTGAACTCGAATTATTC
CAAGACGTCTGCCCGAAGACGTGCAAGAACTTCTTAGCATTTTGTGAGCACAAGGTCCCTGATATCAGCGACGAAGCACAATATTTGGGCTACCAGGGAA
ACCCCGTGCACCGCGTTGTGCGTGGCGGCTGGATTCAAGCTGGTGATGTAGCTGGCAAAGGCGGAGGAGATGGACCTTGTCGGTCCCTTTACGGTCAGGA
GTTTCCCGACGAGAGCTTCGGTATCTCACACAATGCAGCCGGCATTCTTGTACGTCTATAGCTTTTCACTCATTTGCAGTTGGTGCTATCGTATTTCACA
AACATTGTATGCCTTTGCTCTCAGTCCATGGCAAACACAGGCCCACACACGAACGGCTCGCAGTTCTTCGTCACTCTCGCACCGCAACCGTGGCTTGACC
GTCGTAAAGGTACTGCAATGTGAAGCCATTCCAGACAAGGCTACCCCCGCAAACTAACACGCGTATGATTTGCCTTTCGATGACGTTTTTCAGTTGCATT
TGGTCGAGTGGTGAGCGGTTGGCGTACAATTATGACTATCGGAGGACTGGAAACTCGTCAAGAACGACCATGCGTGCCCTGCACCATTGTTGACAGCGGA
AAACTTCAGTGA