Description :
From Genome Similarity Track
Location :
Scaffold_1153:7021- 11332
Transcript NameFunction/comments
Phypl_g12578hypothetical protein

Sequence
4311 bases(100 bases per row)
TCGCCCGCGGCCCTCGTGCAGTGGCGAAAGCTGCGAAGTGAATACGAGGACGAGGTATCAATGCGCTGCAAGAATGATCCAGCTAAAATGGCTGAGGTTC
TCGTCAGCGTGAAGAAATCGTTCGACAAGCGACTTCTTACTGCCTGGTGTGATTTTGAATGGGACACCGAtgtcgccaccgtcaccgaTGAATTCATCTT
GGCAAAGATTGATGAAATCATCTCCTCAGTCAAGAACAACTCTGTACCCGATGTGACAGCTCTTTTCAAAGAGAATGTCGTCATGAATACGGGAGAGAGT
GACGTGAAAGAGCGGGTGATGCAGTTTTTCGTCCGAAGCCGTGAGTTCATCGATGAACAAGGCTGGCAAGGGTTTCTCAccggagaagatggagcgaGGC
TGAAATgcaagctggtggtggaatCACTGGAGCCTCGCACCCTTTGCGAGGAAGTTGCTGCCATCATGAAGTATCAGGCGAGGACGGCAAAGGAGAACGA
AAAAGAACTGTTCAGGCTGATTTTGGAGAAGGCTTTCGACCAGGAACGTGACTTTTAGCTCCGTAAGCGCTCACGCGGCAGAGACCTGGGTGAATGGAAG
AGGAATCAGAATCAGTCCGAGGGTGACAGCAACCAATCTCGCCCGAAGTACCGCAAGATCGAGCGGGGTGGTAGGCCGACACTAAAAGTCGGCGGTGCGA
GTGCCAAGCCAGGAGCGAAGAAAGAAGGAAAGTGCCCCTCCGACTGGTGGTTGCCTTAAGTGCAAGGGCGATCACTGGCTTATTCACTGCCCGACTGTCA
CCGCGGAtgagaagaaggagctaCTCCGGAAATGCACGAGCGTCGCGACGAAAATAAGGGCTCGAAGAGGGTCAGTCGCGACACGTGAAGGCTCAAGCGC
GTGAAGGACTGCCTCCCCAAGCACGACAAGTTCATTGTGCTTGAGGAGGCGATGTCCATGCCCTACTGCGCAGATACAAGGGAGGAAAGGAGCGTAATCA
GTGCTCGGAAactgaaggagctcgaggcaTTGGATGGTGTCGTGGCATCTACAACCTTGATGCCCCCGATTGTGTGCAAGACGGTCGGGAAGCACGAAAT
AATTGCGAGCTGGTCTGTTCTCCTGCACATTAAGCTACAGACAGCGGCTGGACCAGTGAGACCTGTGAAACCATTTGAAGTGTTGGTGATCGATGATGAA
GAGGGCGAATTCATCGTGGGCACATTTTGGATGATTTGGGCATCAGTGTCGAACGACAACTGGAGCAGTTAGTTCGACAATCCGATGCAGAAGACGATGA
CCCGATTGAGTTCGGTGATGGTGGTGGGGTAGGCTGCGTGTCTGATGATGATGTTCGTCAAGCGGTCGATGCTATGATAGCCAAAGCCATTGAGAACGGC
TTTCCCCGCGACAGGGAGGACCGACTGCGAACCATCGTATACATGTACGACATTTGGCGACTTCGGCTGGGACCTGACCCATCAGCGAAGGTGCCGCCAC
TGGAGCTGAGATTGAAAAAGGACGCCACTCCATTTCGATGCAAGTCCAGGCAGTATCCACCTCACCTACCCAAGTTCATGAAAGACTTCAACGGGGAACT
GGTGAGGTTGGGTTGGGTATACGAGAATGCAACGAGCCGGTGGGCCTGCCCGGCTCTACCAGTCCGAAAGCCGGGTTAAGAGGAATACTGACAGGCGAAC
GACTACCGTCCTGTCAACGTAGTGACGGAACCAATCGCAGGTGTGATGCTAATCTTGCAAGTGATTACCGAACATGTTCGCGATAAGGAGTTTTTCGACT
TGTTCGACTTCATCAAAGGGTTTTTGACGGACTCAAACGTATTCACGCCTACGCGAGTTCCGCAGGGATGTAGTGATATAGCAATGCATTTCCAAGCTAC
GATGGAGAAGTGCTTTACCACGCTGCTCTACAAGCATCTCCTGATCTGGATCGATGATATTCTACTCTATGCGAAGGATGTGGATACATACTTGGAGAAA
CTCAGCGAGCTGTTCTCGTTGATGAATGATTTCGGGCTCAAGCTAAGCGCGACCAAGTCTAGTCTGTTCCAAACCTCGGTGAAGTGGTGCGGTAAGATTA
TTGATGGGCAAGGTGTCCGCCATGATCCGATTCGAATTGCGACTCTGCGAGACATGCCATTGCCCACCACTGCTGGAGATCTTCAACAATTTCTCTGTGC
CTGTAATTGGATGCGCGACAGTCTCGTAAGTTATGCAGGACATGTGAAGACCTTGCAGATGCGACTCGATTCGACACTGGGTAGTGGAAAACGAACAAAG
CGAGTTGCAGCACGGCTAGCAGTGACGTTCACCAATGATGAGCGTGCTGCTTATGACAAAGTGAAGAAATGTCTTGCAAATGCAATCAGGTTGGCACACC
CGAGCCACGGTGGTGTCCTCCCTGTGTTCACCGATGCATCCGCCGAGGCATGGAGCGTCACAGTGACGGATGTGAAGACGTGGCAAGGGGGTAAGTCTAT
TGGTGACCAAGACCATCGATTGCTACAGTGTCTGAGTGGTACATTTACTGGGTCGCAAGAAAATTGGAGCGTGAGGCTTTTGCAATTGTGGCAGCTTGTG
ATAAGCTGccgcacctccttctccggcCCGCCGGGTTTCGCCTGTACTGCGACCACAGGAATCTCATCCATGTATTCGCGCCGGACGACACCATGAAGAA
ACACATCAGAGGAAAACTTTTACGGTGGGCTAAGCAACTTGGAGAGTTTCGCTACCAGATCTATCACATCACAGGTGAAAAAAATGTCTGGGCAGACATT
GTGTCACGCTGGGCGCGATTTCCGGCGACTACCAACCTCCGCAGAGTGAAAACCcgtggtcagcagcagcaagatcgcCTACTGCTACGCCCACTCGATG
ATGAGGGCTTCGTGTGGCCCACCATGGAGACAACTGTGGATGCGCAGTGCAAGTTTGGGACCGAGGACGTGCGACAGCGTCTCcatgacggcgacgacgg
ggTCCGGCGGAAAGACATGCGACCGCGGATCCCCACCGTGGCCAGCGacctgctgcgtcgcgtgtGTATCATTGCACATTGCGGCCCCCAAGGTCACCGG
GGCAGGGATGCGATGCTAGCGCATATCAATCGGCTATTCCATGTACCCAAGCTCCGTCAATGCCTGGACAGGTTTTTGGCGAGCTGCCTCCTGTGTCACC
ATGTGATAGGGGGGAAGGTAGTGCCAAGGCCCTGGGGTGAAACATACCAATGCAGTGAGCGAAACCAAGCACTGCATTGGGACTTTCTGTACCTAGACGA
GACCTATGGCAACGTGAAGTACCTGTTAGTGCTCAAGGATGATGCTAGTCATTATTGTGAGTTGGTCAAGTCTGAAACGCCTACAAGTGCAGTTGCAGCT
GAGTCCATCATGGAGTGGCACAGCCAATTTGGAATTCCGCGAGTGTGGATTAGTGACCAAGCCTCTCACTTTAAGGATGAAGTGATTGAGGAGCTACGCA
CTAGACTGATGTGTGAGCAGATTTTCTCGCCAGCTTACAGCCCATGGATTAATGGCTCGGTTGAGCGAGTTAACCGAGATATCCTGCAGGTCCTAAGGGG
CCTCCTAATCCTGGACTACAAGACCAAACCGCGACTGGCCCAGGGTCATACCGATCATGCAGGCCAGTCTCAACTATACTGTAGTACCATCGCTGGCGGG
CAAGACGCCTTCCGAGTTATTTACAGGTTTGAAGCCGCCCTCCCCTCTACATGCCGTGTACATGGACCCAGAGGCAACCAGCAAGGTGCAGCCAGCCCGT
ACAACGACGGAGATCGAAGCAAGCCTGACCGAGCTACGCAACAGTGTCAGATACATTCATTGGGCGGTTGAATATGCCCAATTGAAGCAGACTCTTCTCA
ACTAGAAAAGGCACGGGGTGATAACATTGTCAACTTCAACAGCGGCGACTATGTACTGCGATCCCGAGTGGGTGAGAAAGGGCAGAACAAACTGCTCGTC
ATGTGGATCGATCCATCCCTACGCTGTCACTGCAGCACAGGCGTACAACGTGTTCACGGCGAAGCATCTCGTAACCCGTGCGGAGCTTGATGTGCATGCC
TCATGGCTCAAGTTCTTCGCCGACAAGGACCtcgagatggccaaggagctccGTGAGCACGTGGCCTCTCAAGGGATTGTCCTTCGTGTGCGTGCGCTGT
TGCGGCACCGTTGGAATGATCAAGCAGAACCTACGAGATCCTTGTCGAGTGGCATGGTTTAGAAGCAATTGGGGACTCGCGGGAGCCTCTCAGTGGGTTG
TACAAAGACGT