Description :
From Genome Similarity Track
Location :
contig_200:7021- 8314
Transcript NameFunction/comments
g14205.t1hypothetical protein

Sequence
1293 bases(100 bases per row)
GCTTCCTCACCGCTACGTGTAAGCTAGTGACGGGCACTCACCTGGCCCGTTACACCTGGTAGCACTTAGTAGTCCTTCCCATGACCAAGTTCGAGATGAG
TGAAGACCAGCCCGCCGGACCTCCAGTGATGACCCTGGAGCACGCGGCCTCCCCCCATCTCACGTCTATCGAGTGGCAAGCGTTGCACCGCCTCGCGGCG
GTGTCCTGAGAAACCGTCGTCACCTCGCTGCTGAGCTCAGCGACCCCCGACCAACAGCGCCAAACCATCCAAGAGTTCATGGACCGCGAGCTCGCCGAAG
CAAAACGGCGAGTATCAACTCCCTCGCATGCGTCCAGGAACAATGCCGTCAAGATGGAGACATCCTCCTATTCTGGCGAGGGTCCTGATCGCCTACCTCT
GAATCGCTGGTTCAGAGAGATCGACATCGCGATCGCCTCGAGGCTAATCGAGGCGCCATCAGCCAAGGTGAACTTCCTGCTATCCCGTTTATCCGGAAAG
GCCAAGAATGGGCTCTCGGCAAACTTGTCGTCGACCAGTACGCGTTCCCGACTCTGAGGCACCAGAGCGACCTGCGTCTCGCCTTCGAACCACCGCAAGA
TGTGTCCGCGTTCGAGCTACATTCTTCGCCCTAAAGCAAGGCAAGATGGCCATGCGCGACTACGTCCAGAGAACGCGACACCTTGCATCGTGTATCGTCA
CGAAGCCGATCGACATGGCTTCCCAAGTCCATGTCTTTGTGTTTGGTATGTGAAGGTATGACGCGGTACTGTCTCACGCGCGCCGAGCCTGCCACGTTGG
AAGAAGCCTTCGCTCTCGCGCTACGCGAGGACTACCTGGTGACGTCGTCATACGCCAAGACGATGCCTGCGCAGACTCGGGTGTCGGTACCCGAGCCAAT
GGAGATCGATGCGATCGAGGCTTCGCAGAATCGACGGTGGTCGTCCTCTGGGAGAGGCCGCGGTGGTCAGAATGACCTCTCGCTGAATTGTTTCCGCTGC
GGAAAGCCTGGTCATCGCGCGGCGGTGTGCCGCGCGCCAGCTCCGATCCTCGCCCACATGAAGCACGTCACGCCCGACGAGAGGATTCCGGCCGCACAGC
CAAAAAACGGCCGGGGCCAGTAGGTGCGGGGCGACCTACTGGCTGGAACGGAGGTCCGGGTCCCCCGGCGGCAGCCCGACCTCCTAGACCCCCTGTGCTC
TATGCACACTTTAATGCCACCACTGCTAGTGGCGACTCGAGGCTGATTATTGTCAGCCTTTATGTCGCCGGTGCCCGACGACCACTCCGCGCG