Description :
From Genome Similarity Track
Location :
contig_24:702038- 704493
Transcript NameFunction/comments
g4669.t1hypothetical protein F442_07910
g4670.t1hypothetical protein, variant 1

Sequence
2455 bases(100 bases per row)
TCGTCGCTGCTGCCAAGTTTGGTCCGGGCTGTAATGAGCTCCAGCACTTGCCGAGCTTCGAGCAGCCAGCCCGTAGAAAAGGTGTCAATGGCTGCCACTA
GTGCACACCGGATAGCAAACCACTCACTGTCTCTATCATGCAGGAAATCCACATGTCCGCGGCGTTCGTAGATGTCCCGAATACGTTCATATCTCTCTTG
CACCGTAGCGCCATCCGTGCCATTGTCCGTCGACGTAGCAGCTACATGTGCGATGTGATCCACGTCTGCGTCATGCAGGTCACTGAAGAAGAAGTGGCGC
TCCAGCATCGCCAGCAAGAAGGTCATCATCTGCTCGCCCAGAGCCACTCCGGGGGCCACCTCCTTGCCGTGCGTCTGGGCGAACGTGCCCGTATACAGCG
ACGCGAACAGCACCAGCGTCTCATCTAAGTCCCAGATGAACACGCGTCTCCGCGCACGAGGTTTCGTGAGGCTTTCATCTCGCACAGCCTCAACCTGCGT
CTTCTCGTCTTCATCTCCAGCTTGATCATCCTCTCTCCCCTCTTCCTTCTCTTCTAAAGCCTCCACGTCGTCTCTCTCGCTTGGCTCCGATCTCTGTCGC
TTCATGGGGCGTGACGTCGAGTAGCTGTCGTCGTCCTGTCCACGGACGTCACCGTCTCGCTTGCCACCACGGTTCAGCAGCTCGCTCGGCGGCTCTTGGA
GCGGCGTCACGACCGCCTCGAGCCTCTTGGAGGGCAGCAGCGCCAGCAGCAGTGACAGCAGCGTCGCCCACAGCCGAGCGCGCCACTGGAGCGTTTTCAG
GCGCCGGCGCTGGAGCGTCTCTACCCACTGCAGCCCGAGAATGACCGTCACGGCCCCGCAGAGACTCACGCCCACCACCGGGAGCAGCACCAGCTTGGCC
ACGGCGTCGCCCAGTCGCGCCATCGTTAGCAGCAGCGTCTTGTCCTTCGTCGCGAGCTTGCGCGAGTGAGCGCTCAGGGCCAGGGTCGCGTCGAGCCGCG
CTTTCGTTCCGAACGTCTTCATGACCGGAATGCGTCACTGGCGAAAAGTCCAATAACAATGGAAGAGCCTTTTCATAGTAAGAAACAAAGACAAAGCGCG
CTGTATTACGGAAAGTGTGTCATCACTACGGTTGCCTTTTGACTGTGTTCATCTTGTGGAGATACTTGTGCGCTGTTGCCATCTAGGACCCGTGAATCTA
CACGCAAGCAAGGGACAAGCACGTGATAAGTGAGCTACCGCATCGAGGTCGCCGTCTAGATGAACAGTTTTGTAGAGCGGCGCAACTTGCGCTTCACTCG
TTGAACGCGCACAGATCGACTGGCTGGCAGGTCGGCCACGTACCGCACAAGACAGGTCACGCCATTGCTGCAGCACCAATGGAAGCTGCTGCGCCTCGCT
CGTCGTATTATTCGGCACGTCCCTAGACAGTAGCAACATTAGTGGACACCCAAGCCAGCCACAGCTTGTCGGGACAACCCACCACCACACGAGCTCGTTG
AAATGGTCCTCGACCTCCCAGATACGGCCTTCGTCATCAGTGTGTCGCAGCCCACTATCTTCCAGTACGAGGCCTGGCACACCACACCGAGAACCGTCAG
TGGGACTCCCTGAAACACCGCCAACCAGCACAACGCACCGGTGAAGCCCAAGGGCGCCAGCGGCAGCTTCTGGCCCTGCAATTGGATACCGCGGAACTCC
GCGCGCAGCATGTCGTCCTGGTCCTTGTCGCTCTTCTTCTCCGTTTTGACGTCCTGCTCCTCGGATCCCGTCCCGTGGTCGGTGCTGTTGCTGTTGCCGT
CCCCGCACTGCGGACGGAAGAACGTTTTCACGGCTGCCGGCCCGTCGAAGTGGATGTGGCAGGGCAGCGAGTGCACGCGCACGCGCTCCTCCGCGGGCGG
CAGCGGACATCGCGTCAGACACACGCGCACAGCTCCCGACGCTTCTTCTACCATCGTGCTTGAAAATGCAATTATTGCAATTATCGCGGGAACTATATTC
CCGCCAAACAATTATAGCCAGGATAAACCTTCGACGCCGTGCAATGGATGCGGTTGGTCCGAGCGCTGCCTGAACGCTCTGTCGCTTCCACGAGCTTATA
CAAGGCAATGCCCTTCTCTGTGTGTGATGCTGTATGGCACAGTCGAATGCACCCGCGAAGCGCTCGCGCGACGAAGCCAGCAAGCTGCTGGGCGAGAAAA
TGCTGCAGGTTTGGCGATGGAGACGCTCTTGGCTGGTATTGCAAGAGCTAACTGGTTGTGGATGGAATAATTGCTGCAGGGCTGGACGATGCTGGGCGCC
AGCTGCCCCGTCGAGGACTGCTACACTCCTTTGATGCGTAACAAGCAGGGAAAGGTGGCGATATAGCTTCAGACTTGGTGGCGTTTTGGAAGATGTGCAG
CTGACGGTGATATGTGCTCTCGTTGGTAGATGTTCTGTGTGCGGTGCGAGCAGTA