Description :
From Genome Similarity Track
Location :
Scaffold_874:7020- 11406
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_874-fgenesh-gene-0.1Kinesin heavy chain
Pytar_ATCC12531maker-par_contig_874-fgenesh-gene-0.2Gene of unknown function

Sequence
4386 bases(100 bases per row)
CGCCCGCGGGGGTCCGCGTCTGCGCGCGGTTCCGCCCGCAAAACAAGCTCGAGCTCAAGCAGCAGGCCGTCGAAGTCGTCCAGATCGAGGACGACACGAC
CGTGCGCGTCGGCAATGGCGCCGGCAGCTTTGACAGTGCGCACACGTTCACGTTCGACCGCGTCTTTGGCATGGACTCGACGCAGGCCGACGTGTACGCC
GCGACCGCGCAGCCGCTCGTGCAGGCCGCGCTCCAAGGGTACAACTGCACGTGCTTTGTGTACGGCCAGACGGGCACGGGCAAGACCTTTTCCATGGAGG
GCGTCCCCGGCGACAGGGACTATGCCGGTATCATCCCGCGCGTCATGGACGACATTTTTGACGGCATCGACAACATGCAGGCCGAGCTCGAGTTCATTGT
GCGCGTGTCGTACATTGAAATCTACTTGGAGAAGATCCGCGACCTGCTCAAGCCGTCGTCCAATAATCTCAGTGTGCGCGAGAGCAAAGACCGTGGCGTG
TGGGTCGCCGGCGCGACTGAAGTGTGCTGTGCGTCCGCGGACGAGATGATGGCGGTCATGCGACTCGGCGGCGCCAACCGCGTGATCTCGTCGACACGCA
TGAATAACGACTCGTCGCGGAGCCACTCGGTGTTTATCATCACGGTCGAACAGCGCAACGTCTCGACGGGCTCGACGAAGAGTGGTAAGCTCTTTCTAGT
GGACTTGGCCGGCTCTGAAAAAGTCGGCAAGACCCAGGCCAAGGGACAGACGCTCAAGGAGGCGCAACACATTAATAAGAGTTTGAGCGCTTTGGGCAGC
GTCATGAACGCGCTGACGAGCGGCCAGGCCAATGCCCACATCCCTTACCGCGATTCCAAGCTCACGCGGTTGCTTCAAGATTCGCTGGGCGGCAACTCGG
ACACGACGCTGCTCGTGTGCGGCAGTTGTAGCAGCTATAACGCCGAAGAGACATTGACAACGCTGCGGTTTGGCCAGCGCGCCAAGAGTATCAAGAACAA
ACCCAAGGTCAATGAAGAGCGCACGGTCGCCGAGTACAAGCAACTACTCATGGAGAAGGAGCAAGTCATCGCAGCGCTCCAGGCGCAGATTCAGAAGATG
GCCGACTCGCCCTCAACGAACGAATCAACGGTAGGCAATCCTGAGGGAGGTAGCGAGACCCAGGTGCAGACGATTCCAGAGCTGCTTGCAAAACTCGAGC
AGCTAGAAGATGAGCAAGTGTCCAAGGTGTCGGAGATTTCGAGTCTGGAAGAGCGCGTCGCCGAGCTCGAGTCACGGCAGCACGAGTGGCAAAGCAAAGA
AGTTGAGTTCACGAAAATGGACCAGCGTACCGACGAACTGACCAGCCAAGTCGCCTTTCTGGAAACCGAACTCAAGGCTAAGGTCACGGAATGCGAGCAG
TTGCAGGCGCTGTTGCAAACGCAAGACACTCTCCCACTCGACGATAGTGCTGCCAAAGCGCGCCACCGGTTCAGTGATGCCGACGCAATGAAGCCCCAAC
CGGTGGGAACGCTGCCCGCGAGTCGAGGCACACAGATCGAGAAGGAGCTGCTTCGCCAGCAGCTCGGTGCCAAGTCTGCTGAGCTGTCGATCTGCACGGC
GCGCATGCAGGCGCTCGCTGAGGAATTGACCAACTGCCGGGGCTTTTACGAGCGCCAGATTGGATTGCTCGAGGAAAAGCTGCACGAGTACGAGTCCCAC
GTCGTGGGATTCATGGCACTCGCCGAGAGCGACGACACGAAGCCTTCGGCCCAACTGGACTCACTATTGCAAAAGAGCAAGACGCTTCGCTCGGTGCGTG
GCGGACGCTCAGCAACCACACAGGGCGTCACTCCCACCAAGGAACTGAAGGAGGCCCTGGCCGCAGCGGCGCCGTCGTCTCACGGGGCCAAGGCGAACGG
CGACATCACGACCGAGCAGGAACACCACCGGCCTCGACTAGTCAGCGCAGCCTCGACCGATGGCTGGGCGATCGACGACGAAGTGTTCCCCATGGCACCA
ATCGACATGGACTCGCCCATCGTGCAGCGGCTCATTGCGAGTATGCCCGAAAAGGGACGTGAGAAAGTGTACAAGTGGCTCGTGTTCGTACTCGAAGGCC
GTGACATCCGGTCTAATTTCCACCCCGAGCTTTCCTTGGAAGGCATCAACGACGAGATCAGCCGTGACATGCGGCGGCTCATCATCCCACTACTCAAGAA
GCGCCAAGACATTGCCGTCGAGTCGTACGTGCGCACGCGATTTGTCAAGGTCTCGGACCTCAAGATCAAGCTCGTCCACCGCCACCGTGACATCATGCAC
TTGGCGCCGACCGTGCGTGACGAGACGCCTTTGGACGGCGACGCCGACAGCTTGGAGAATGGAGCTGCGCGCCCGCCGCGGCGGTCGTCTGCTCCTACTC
GTGATCTGGGCAAGATGTGGGCCAAGGGCCACTTGTTCTACGGTCCGAAAAGTGACCCCGCGAGCGAGTCGGTGCTCCACGTGCAGCGCACACCGGCGAC
GACCGGACGGCTTGACCGGTTCGTGTCGGAACCGGTCGACATGAGCGCGACCATTCTGGAATCCAAGACCATTCTCGCTTCGGGAAAGGCTGGTAGTGGT
GGGCCACCGAGCTCGTCGGCTCGCTCGTCTAGAGGATCCTCCATGAGCAAGGAAACCGCCACCACCACGACAGCGCCAAGCTCAACGTCCAAAGAAGGCA
GCGGTCTTGGTGGCATGTTTAGCCGCCTCCGTGCCCACCAGGCCAGCGTCTTGGGCGACGTCAAGACGGCGCTGACGGCGCGGTACAACAAGCACCACGT
CCATGAGGACACGATGTGCGACGGCTGCGGCGTGAGCCCGATCGTTGGTGCCAAGTGGACGTGCAACACGTGCGAGAACTACGAGCTCTGCGATACGTGC
TATGGGCTGGGCATGCACGGCGGCGAGATCAGCCTCGAAATGTGTCGACGCGTCGAGCAGGTCGCGACGCAAAAGCACCGCGTGTTGGCGCAGTTTCCCG
AACTCTTTGAGCTGTTGCGCAACCACATTTGCAGCGACGACGTGATCCATTTCCGCCAGATCGTTGACTGGCTGTGTGACATTGTGGGCGGCAAACCCGT
GGCCCAGCTGCGGCAGCGCAGTATCGTCAAGAGCGGACTCCACCCCGAGATCCGTGCGCGGCTAGTTGCGCAGCTCGGCGCGATCGCGAGCGAGCGCACG
GACCTCGAACTCAAGACGGAGTGGTTTGTGCCAGCCGACGAGGAAGAAGACGAGCAGGAAGAAGACGGAGAAGACACGGAGAACGACACCCAGTCGTCCA
AGAGCGGTGGCCCGCGCAGCGACGACGGCGCCAAAGAGACGGAGCCAGCAGTCGAGACTGGACACAGTACACCGCTCGAGACACTGCGCATGTATGTGGT
CAACGTCGGGTCGTCGACAGAAGCTGCAACTGCACCTGCATCGTCGGGATTACTGCCGCCGCTGTCGGTGCGAAAACTGAGTGATCGCTATTTCGCGAGC
GTGACCTCTTCAGACGACGGCGGCAACCACTCGGTCGTGTCTGGCTCGAGTCGCAGCGACAGCGTCGCGACTGCAGAAGGAGCCTCCCGTTCATAGTCTT
TGTCTTGTGCACTTTCCCCCACTTAATAACAGTTAGTCAGTAGAGATCCCTTGCGTGTTCAGGCTGTGGGATTTGTAGCCATCTCTTCCGTGTGTTGCAG
CGAAACTTTCAGTAATTCAGTACAGTACACGCACGTCACGTCTAGGGAGTAGAGTACGTAGCCAATGGCAGTGTNNNNNNNNNNCGTGTTGCAGCGACAC
TTCAGTAATTCAGTACAGTACGCGCACATCACTACAGTACGTAGCCAATGGCAGTGTGGCCGCGTTGATTGTTTAACAAAAGGAGCACTGAGGGGAGAAG
CAAATGCACACGAGATTCATTCCGATAGTATCCACAGGAGATACCTCCTGGTGAATCAACATGGACGGGAGTGGTGGTCACCGGTTGCGGCTTAGGCGGA
CGACGTCCTGGCCATGAACTTGGCGACAAACTCACGCTGGTGGACCGAGAGCCCCCACACGGGCGCGCCCTTGACGACGAGGCGCTTGAGCAGTTCGGCG
TGCTCGCTCTCGGCCGTGAGCTCTTTCCACGCGGCGTCCTCGTCGCCCGCGGCCGGCAGCGACGCGCGCACGGCGGCCCAGTGGTCCATGAGGTGCTGGA
GCTGCGCGACGTCGGTCGGCTCAGCGCGCGAACCGGGCTGGAACACGGCGTTCTTTTCCGAGCGCGACTTGATGGAGCCGTAGAAGCCGCCCTGGCCTTC
GGTCGGCTGGCCGCCCGAGTAGGTCGTGAAGGCCGCACGCACGGCGTTGTGGCGCGCCGGTCCACGCAGCGATGCGCGCGCGATGG