Description :
From Genome Similarity Track
Location :
Scaffold_26:70179- 71632
Transcript NameFunction/comments
Phymu_g1641hypothetical protein PHYSODRAFT_354319

Sequence
1453 bases(100 bases per row)
CTGTGTGCTACACTTAACTTGtctgctgcacgtgctcctcAAACACAGGGCGGGCCCCCTTGATGTTCAGTTGAATCGTCGCCGGCTCTGCGCGATCACG
AGGAAAAACCACAATGTAAGCAACAACAAACGAACCACGCGGGTGCCTGCCATAAACTACTTACGAATCGAGTCGTCCGACATGATAATCATGATGTACG
TGTTGgcagtgaagaagtcgatgaAGGCCGTAAAGTTCGAGTTGCGCACTTCCATGCCCTGAAACTGCGCCTGcgttttgctgcagctcagcttgaactg
cttgatGATGTTGCTGATCTTTTCAAAGCGGTGGATATCACGGTGGTTTGTGTGTGTAGCGTGTGAGATAACGAGGAAGGTCGCACGCTCAAACAGCACA
ACTTCATCAGCGCTacagatcgagcagaagctgttcagGTGCTTTTCCAGGTCCTGCATGTTCGGGATCAGCGAATACACGATGGACGACCATGCGCGAT
ACAGCGTTTCGTCCCAAATGGACGTGCCAAAGCACACAGTTGGTAGCTGGCCCGTGCGCTCCAAGatcatctccttcttttGGTTGAACACCTGCAGAGT
GTACAGTTGTTTAGCCAGTTATCACTTCAAAAGAGGCATCTTCCGTCACGTACGCGCTCACGCTGGTCCTCCGGCACCAAATCCATCTTGTGGATCAGCA
CGAACACCTTCGCGTTACTCGAGTTTTGGTCGATCGCTTCCAGGCAGCCATCGAAGTGAGCCATGTCTTTCTGTAGGGGGACAGTCAAGACGGAATCAGT
ATCGCCATGTTCAATTTTTCAACTATCAGTAAATCGTACGTCAATTTCGCGACTTTCGATATCGAACACATAgatcagcagctccacacTGCGGAAAATG
TGGTCGCGTTGGCTCTCAAAGTAGTTCTCGTAGAAGGCATCCTGGCTTCAAGCACCACAGCACACACCACCGTCAGCTCAACCATTAAACATATCAGCAA
AAGAGCTTTCTCCTGTTGCCTTACCCGCCACAATCCCACAGATTCAGCACTAGATTGCCTAAGAAACGCACGTGCGAATGCTCCACATCCACTACAAGCA
GTAGCAACCACAGTCCAGTGAATCATCTTGTAAGCGTACAATAAGACTCGCAACATTTTCCTCAATCACGTACGCGTGGGCCCCAGTCGCATCGTGTCAC
GAGCTGGTAATAAACACAGAGAGATTAGGGGGATATGGTTACTAAGAGGCCCGTTGAGTAGCCACAGCATCAGAGGACTCAGTACCCAGGTAGTTGGCGA
AGATAATGGAGCGCATGGACGTCTTGCCTGAGCCAGACTTGCCCATCAACAGAACCTGTAGGCAACAGAAGCCTCTTAGGTGAGTATACACCTCATTGAG
ACGGCGTGTTGGAGGGAGACGCAGTCTAGAGACgcactttcttcttcatggtg