Description :
From Genome Similarity Track
Location :
contig_4:70173- 74506
Transcript NameFunction/comments
g1060.t1hypothetical protein L917_20894, partial

Sequence
4333 bases(100 bases per row)
TCCTCGCCGCGGCGTCGGGGCTTCGTGCGACAGCAGCGAGCGACGGAGATATCTCCGTGCAGGCCGCGAGCTGCGCTCTGCTTTGCAGGCATAGGCACTC
ACCATCCTTGCCGCAGCGCAAGATGACGAGTATCCAAGGCAACACACCTCACAAACGCCTATTTCGCTGCACGAGCTTAACTTTCGGCTGGCTCGGTTTC
CGAACTGCTGAAACGCATGCCGGCGCTTCCGGCCCCATCTCCAGTCCGCCCGGTGATTCGCCCATTTCCCGTCCAATAGTGTGCATCCATTGGTCAAAAG
TCTGTTTTATCAACGGGAGGGGGCCGTTGCGGTCATTTCCACCGAAGCCTCCCATCGAGAAGCTAGCGCTGCGTGTGTGCGTGCCTCGAAGCGCTTAGCG
GCAGTCCGCGAGACAGACAGACGGACGCAGGGCCCGACAGGCATGCTGCGCTTCTAGACCGGCGCTTCCTTTCTCTCGTCTCCGCCCCCAAGAAGCAAGA
GAGGAAAGAGCCCTATAGTCCCTATTGTCTCCCTGCTGGATGGCAGACATCGCCATGACTGGAGAAGCCGGCGCCAACCGCACGTTCCGCTCCATCTTCG
GCGACCAGGAGCAGCGGCACGACGAGGTGCATAAGCTGGAGCTGGGCAGAGCGTCAGCAGCAGACCCGTCGTCACCGACTCGGGTGCTGGACTGGCCATG
GACGACGACGACGAAGCCATGTGGAGTGACGAGCCGCCGCTGGGCGATGCAATAGCTCAGGATAACAACGACCTGCCGGGGCTCCAGTTCGCGGTGCGTT
GTTGGTGTTGCGAAACGGCTAGGGAGTGCCAACCTTTGAATTGACTTTTGGTGTTTTTGCTTGCGATTCTCAGCAACGCAAGTCCATGGAAGAGTGGGCA
GAGGATGATGACGAAGAGGAAAACTGGAAGGATGCACTGCAAGACCGCGTCAACCAGCTGGAGCTTGCGTTCCAACACAACAATGACACCGCTGCAGCAG
ACTCCCGGCGTCGCTTCGAGCAGCAGCAACTGCTGCAGTTTTCAGCGCCTGAGACGCATCACATCAACTTTGGCCAGACTCTCCCGGTCTCAGCGCGCTT
CACCACGACGAACTTGGGCTCGGAGCGCTTGCGACCAGCTAGTCGCCATAAGATGCAGCGCACATCCTCGTCGCATGCATGCATCACTGGCGAGGCTGCC
GTTCAAACTGCGTCTGGACGCTCAAACCACCTCTGGAATTTCCAACGCAAGGTAGCGGGAGGGACCACACCGACTCCGATCGCTCAAGATGCACGCAAGC
GGTCAACCTCCATAGATTTCGTGGCCCGCAACATTCAGACAGTCGAGCACCATCGCAAGCGCTCCGGTTCTTTGAGTGGGGCATCCAGCAGGACCGATTC
GCCTCGACATTCTCAGTCCCGGAAGAATTCCTTGGACAGTAATCACAGCAGCCTCGGCCGAAGTAATAGTAGTAGTCTCCACGGGAACACGGCAGCTGCA
CCAGCCGACAGCACATCATCAGGCGCGGCGGTATTTAACCTGAGCGACACGGAAGCCATTCGCCGTTTTGTGCTCGACGACGTCAAAACGGTAAGTCACC
CCTCTCTGTCTTGGAACGCTTGAGGCTGCGCTCTGACATTGTGCTCTGCTGTGAATAATGCAGATGTCCATGGAGCGACTGGTAGGCGACGCCCAGCGCT
TACATTTTTTAGAGGATTTCTACCAGAATCACCACGCACCAGGCCCCGGGCCGGCCGCCGCGGCGCCACCGTCGCCTTCCCCCTCCTCAGCTATGTCCAC
GTCCTGACCGCACTCTGTTCTATTACATTCCTTTGCCTTGCCTTGCTGTTCGGATGCGATATTTTGCTGCATGCTCTATTTAACGACATTTTAATCTTTG
CTGCAACGCACGCCATGTGCGTCTTCATCTCGTTTCTTGGTTTGTGTTATGCTTCATTCCTCTGCGCAGCATCTAACTACGCTACGTGCAGGCTGCACTG
CAGCCTTGGGCTTGGTCACGCCACCTGGGCGCTGACTGAAATCGAAGGAAGCAGCGACCTCAATCGCCCGTACGATTTGGATGCAGCAAGAATCCTTCTC
TATACACGGGCAGCGAGGTGTATTCACCTCCAATCTTTCGATCACAAAGCCGATTGATTCATCTACGACAGCTCGGAGGTGACCTCCGCCATCAACCTCC
GATACACCGGCCCCTCCTTCTAGTTGGAGGTATGGGTAATGCTGACATCTTAGCTTCGCGTTCTTTTTGACGGACGTGGAGATCACTAACGCGTAACATG
CTGACCTGTGTATTGCTTCCCAGGCTCGAATGCTCCTCGAAGGCGCTCTCGCTGTAGAGAAGACAATCAGATTTGCGTCGGCTTGAGAATTACTGCGATG
ATGTGGAGAGTGGCCAGTTCTCATACGAGAATACTCTCTGTGTAACCACGATATGCATGAAATGTAATGTGACTAGAGCTGTCGTGGTTAACTAACCTCA
CCTCTAATCGACCCACACCTCTACCTCTGGCCTAACCTCTATATCTGTGGCCCACACATTATTATCATACAAAACCCAAGTATAAACTAGTGTTGGCGAA
CACAAAGAACCCCGTCCGCAACGACATTGGCGAGATCAAGCTACTGGAGGCTAAGAGCAAGGAGGATGTCAAGCAAACCAACGAGCTGCCCAAGGGGATG
AAGGCGCTGTAGCACAGCGACAAAATGATGGCGCAGTCGATGGCCTTGAGCGGCTGCAGCGAGACCAACTACCGTACCGTACAATCTCCAGACGTGCCAG
AGGAAGTTCCTCCACGACATGCATATCTTCATGCAGCTCTGCTCCAAGGTACAGGGGAACTGTCGTACCGACGAGAGCGACGAGTTTGGAAATGCGCAGT
GAAGAGACATTCAACTTCGTTGCGGCGGCACTTTAGTAACGCGTATTGACTTGACCAAGTATTTCTCCACTATGGCTAAGTCATCGTCTTCCTACATCTT
CCTATCGTGAATCAACACACTCACACCGCCGTAATCGATCAAGGAACCCTGCATGCCTTGCCTATCGGGTGAGAGCTCACCTGTTTCGGTTGCCTTCGTC
ATGCATCCCTGTGAGTTGAGGTCATCCGTGAATATGAATTCGAACGCAGTGCTTGTTCGAAGCAGATCCTCTTGCTCGACATCGGCACGACTTGCTTGCT
ATCAAGGCGGTATTGATGCCAATAAGGACCGAAGACATGTAGGGCACAAGTGTTGTGAAAATGACTCATGTAGTCCGTTTCCGAATCACGAAAGCAATCG
TCATATTACACCGCTTTCAATACACGTAGAGTGACCGTTGTCAAACTCTTCGTCGGAGATACCAGTAGTTCGGATGAGGAAGCATTTGAACAAATAACCA
CAGTTGATACTTGTGCTGGCGTCGTGCCGTAAATAACCGCGTGGATCACTATGAAGCCGTGTCCCGGGCTTAGGAATGCTCCAGAAGCGTACAGCTAGGT
CTAATTTTGGATCGCGTTTGGGTGCGGCTGCAACCTCCTGAAGAGTGGCTGTGGGTCTACTGCTTGATGCGCTGGCAATGACGACATCACTTGCACCTGT
TACTGTTTCTTTAGCTGACAAGGTGAAGAACAGGACTGAGGATGCCGCTGTCGTGTAGGAACACGTCCAAAATATGTATGCACACTCCCACCACCAACAC
CACCAAATCCACGAGGATTCAATGAGCTTTGTCGGGCAAATAGAACCTGGAGGCCCTAGTTCTCGCCCTTACACCGGATTGGATGTTTCCTCTGCGTACT
GTGGTTTCCGTAGGCTAATAACCAATATCCAGCACCACTAGCCACGAGCGACGGCTAGGATGCTCTTCTCACACTGAAACCTCGTTGTCCCTCAGAAAGG
AAGGGTACGAGCCGGTCAAGGTCTTGTACGAGGTGCCGGGGCTTAACTCCGGCGGGAAGAATATATGGGACGCACTCAGGCGTTCCCAAGTGCCAACGAG
TTCTCGTTGGTCTTCTATCACACGCACGGCCACTCTCTCTCTCTTCTCTTGGCCTACCAGATAAACACTAGCCCACACAAACTACGTGTTCACCAACATA
CAGTTCCTACCCTACCGAGCGGGACCAGACGCTCCGGACACTTACCGAAGCCGGACTTGACTCTTGAGTGGTTGAGAGGAAAATATGTTCTGTTTGTTGT
TGCCCAGTGGCCATTCCTAATGCTATGCTTTCCTATGGTTCCTATACAAATATCTAGTGTAAACGAGTCCGTTACGGATCTTCTCCGTAACCTACGAGGA
CTCCACCGTCGCCGACGCTTCGGAACAGTCGAA