Description :
From Genome Similarity Track
Location :
Scaffold_1:701718- 709720
Transcript NameFunction/comments
Phyra_38638cytochrome c peroxidase, mitochondrial precursor
Phyra_72784Hypothetical protein
Phyra_72785Drug/Metabolite Transporter (DMT) Superfamily
Phyra_72786fat-free family protein

Sequence
8002 bases(100 bases per row)
TTTATGCGGCCCTTGAAGGCGATGTCCGACCTGCTGGGTCTCGATCCTCTCCTCCGAAACCTCGTCATTCGCCAATCTTCCGCGTCCAGCTCAAGTCTAG
AAGCCCCCGCCCAACACCGTGAACATGCTTCGCCGTGCCGCCCTCCGCGCTGCTCAGCAGGCGTCCGCCGCGTCTGCAGCCAAGACGCGCGGCTTCGCCT
CGTCGCAGCTGCGCACTGCCAGCAAGAAGAAGCAGCCGAACGCCATTGTACTGGCTGCCGCGGGCGTCGCGGCCGTGAGCGGCCTGGCGCTCACTGACCT
GGTGAACGCGCGCGAGAAGCCCGTGGACCTGGCCGCCATCAAGGAAGAGATCGTCGAGATCTTCGACGAGGACAACTACATGGGCCCCACCATGGTGCGT
CTCGCGTGGCACTCGTCGGGCTCGTACAGCAAGGAACGCGGCGGCAGCGGCGGCTCCACGGGCGGCACCATCCGCTTGGACCCAGAGATCAACCACGGTG
GCAACGCCGGCCTCCACCTGGCCGTCAAGGCGCTTGAGAAGGTCAAGAAGAACCACCCCGAGATCTCGTACGCCGATCTGTACATCCTGGCGGGCGTGAC
CATGATCGAGGAGATGGGCGGTCCGGAGATCCCGTTCCGGCTCGGCCGCCCTGACGCCAAGAGCGGCAAGGAGCCCACGCAGACGCCTGACGACCGCCTA
CCCAACGCCGACATGGGCACCAAGGACAAGACGACGCAGCACGTGCGCGACGTGTTCTACCGCATGGGCTTCGACGACCGCGACATTGTGGCGCTCGTGG
GTGCGCACGCCATTGGCCGCTGCTACCCCACGCGCAGCGGCTACAGCGGCCCGTGGACCAACGCCGAGTGGACGTTCTCGAACGAGTTTTTCCGCGAGCT
GCTCGAGAACAAGTGGACGGTCAAGAAGTGGAACGGCCCCATGCAGTACGAGGACCCCACGGGCAAGCTCATGATGCTGCCGGCCGACTTAGTGCTCATC
CAGGACCCGCAGTTCAAGAAGTACGTCGAGCTGTACGCCAAGGACGAGGACCTGTGGTTCAAAGACTTCTCCAAGGCCTTCGTCAAGCTCACGGAGAACG
GCGTCAAGTTCCAGGAGACCTCGGGCTGGCGCAAGTTCTTCGGCGGCAAGTAATTGCCTGCGTTGACGTCTTTTGAGAGATGCAACCTCCTTTGTTTGCG
TGAGTGCAACAGCTTCAAGACTCTGGTGGCTCCTCGACACTGCAACAATCACTACCGTGCAGACTAGCTATCTGGACAACCAAGGGCTGCTCACAAGCGT
CCAGTATGTAATACATCGTCATGATGAGAAACGGCTACATGTCCTTCTAACTCGCGTTTGATGGTGCTGCCGTGCCATGTTGATCTTAGCAACTATTTCT
GTCGTGCTCTATGAGTTTGTCTGCCGCTCGACTTCCGTAGTTTCCATGAACGAGAGCAATGCACGCCGTGCTCGACGCCGTGAGGTGGCTCTGCCGTACG
AGAAGACTTACCCATGGGAAGACGAGCGTGGGTCGACCGTCGAGCGCACCGTGGAAGTGAACACGGAGGCGAAGCGCGTGTACGCACAGCAGGAACAATT
GCTGCCGACGCTGGCGCTGGACAAACCATCAGACCCCGCAGCTGCTGAACACCTGCAGAATGTGGGGCGCTGCGTTTTGCTCCTTCGTGACACTACGAAG
CGAGCACGCAAGAAGAATGGACCAGAGCATGGTCCTAAGCTGTCCCCCAAGCGGGTGATCCCAAGTCGGTTCCCCGAAATCACGCCCGACGTTGACGAAG
AGGACGCAGGCGAACCAGATCGGGTTGAAGAAGAGGAAGACCCCGTTGTGACGGATGGCCGTATCGTGAGCGAACATTTTGCAATTGATACAGCGAATTT
GTGTTGACCTTGTGCATATGGTGAGTGTGTAGGCAACAATGCTCATGGACCAGGAATGGGACACTCGAGCATGGAATACGGTTAAGGTCCGAACCGCGGT
AGACACTTTGTACGAGGAGATAGAGCACTCCGAGGACGATTCAAGACGAGAACTTGCTACTACAATGCTACTTCGTCTGCTGGAGACCCATGAAGGTCGG
TACGCTCGTCGGCTTGAGAAAGTTTGAGGACAGCGCCGACAGGGACCGCGACGATGCAAACGGTATTTTCGTTGCTGACTGTTTTGTTGTACTAGATGCT
GTGGACTACGTTGAGACCACCTTGCCCAGTTTGACCAACAAGGCGTTCCAGACGCTCTCAAAGCTCACAAACAATACGAAGATCTTCCGGATGGCACGAC
TCGTTGCAGTGCTAGCCGAGTGGTTTGCGCACGTACTCTCGAGTGAAAACGCGGCGAAGAAGAGCGTAAGTTGTTTGCTGCGCGAAACCGAATTGTGTGC
GCGTATCCTACAGCACCACTGGAGAGGGGTAATTTTCGAGCGGACTGTGAACCAGCGCGATTATGACCCCATCGTCCGAACACGCTTGCGCTCTATGCAT
ATGATCAAGTTCGTCGAACTGCGACACCAATTTAAGGTCTTTCGGGAAGCCATTGGGCCTGGAGGAATTCCTAGCAGCGTGACGCTGGCGTATATCACGA
TTTTGTACCATTTGGTAAAGCCCCAGCACGATGCTAATTCAATATCGGATAAAACGCACAACACTGTGATCTCGGACCAGAGGCGTATCCTAGGTTCGGG
TGTGCTAGTGTTCATCGCATCGTTGATCACCAAGCGCCAGAGCCGCGAAGTGATCGAACTGGTGAAAGGAATTGTGCTGGAGATTGTCGAAGGTCATGGA
GACGAGCAGATTGTGGAAATTCTTCAGTGCAATGTCGTGCAAAGGGTGCAACTGGACTTGATGCGCACTATACAAACGAGTGCCGATTTAGCTGGTGCTA
CAGCTGCGCTAACAACGTCACTAAATCTGCTGTCCTGCATTGCCACGAAAGTTGTTCTGGCGACAGAACGATGGGGGCCTCAGATCCCTGTTTCAAGTAC
ACCTGTCAGCTCCCTCGACCATAGTCCGTCCCGGAGAAGAACGCCTTCGCCTACCAAAGCGAGTTTGGAGGAACAGAGTTACTTATTGCGGAAGCTGAAG
GGATCGGTGCAAACGTTTCTGCTTACTGCAGACGTGTACGACACGCTATTTGAGGTTCTTTGCTTTTGTCGAGACAAAGGTGAGCAGCTGCGGGCACAGG
TACTTGAGATCCTGTGTTTGCTTTCGCGTTCACTCGGCTTCACTCAACTGCTGGATGCACTCACTCGATGCGGTGGTCGGTGGCTCGAACAAGTTTTGTT
ATGCATGAAAGATGCCAACTTGATTGTCGTTCAAGCATCGGTGACTTTATTTTACGAAATGACTAGCCGTGCAGATGCTCGATTCGGTCTCACGACGGCA
GGTGCGGTGGAAGTATTTATGCGATGGTGCCGACCAAGCCTTGAGGCTTCGGAGTCGCGGATGGCGTTCATCCTGGGACTTATCGGGTGTGCGCTCCTAG
CTCGACAATCTAATCAAGTGAAACCCGTAGCATCACTGCTGGCAGCGCTGGCGACTTTTGATGACAGTCTTGATGCATTTTACACTCTCTTGTTAGACTT
GGCTCTGCAAGATGAGTTTTCCTCTCGAGCCTCAGAGAAGACAGCTGCTTACTTCCTTTCGGTCAACGCACTGCCCACGCTCGTACAATTTCTCACTCAG
GTCTCGCCGAGCTGTATGGAGTCACCCGTGCAGAATTCTCGACAGCGAAACATCAGCTGCATTCTACTCGGTCGTTTGTGCAAGGTCACCAACGTGACAC
GTGCGTGCTTTTCTGAAGACGTCGTCAACCACCTCTCCCTCTCTATACAGTGTAATCGCCTTGATGAAATCGAGGGCTTGGTGGCGCGTAGCTCCTCTGA
AGATCGCTTCATCCACCAGCTCGGCTCGAAAGAAGCATGCAAGGCACTCAGTCGACTTGCGCGGTGTCCCAGTAACCTGGTGGATGCACGACTCCGGCCT
TCCGTGACTTCACCTCAGGTTCCAGAATGGCCCCAAGCTTTAATTTGCGACGTGATGTTCCGCATGCACGTGCTCGAGGACTTAATTGCGCTTATTCGAA
ACCCGAGTGACGCTGTGGAGTTTGCGCAAGTGGAACTAGACAAGGTCGTTGCTGCAGTGGAGTTGACGGGTTACATTCGGCCACTGCCTTACGGCGAAAG
TGCCCGAGACAAGTTTCTAAAGACACACGCGAACCATCCGCACGGAATATTCTCTCAAGAAAAGTTGCTGCAACTAGTCGAGCTGGTTGCTCCAGCCATT
TTGCACGTTCTCCGCGAGAAGAGCATCGGGTTTGACCTCGTAAGTGCATGCTGCGTGGCATTGAGTCGTCTTGCTTGCACAAACGCTGCACGCAGTCTGC
TTCTCGCCCAAGGTTGTCTGCAAACGACACTTATTCATTTACCGGAGATTTTGATTGCGACTACAATGGGGAAATCCTCACCCAAGCATCAAATCGTGGA
GTTCGACTCATCTGTTGATGATCACGGTCTTCTTGATGTACCTGCGGCACTATATACGCTCTTTGGTAAGTTGTGTGCAGTTGCTGATGGCCGGACAGGG
ATCATGCGAGCCCAAGTACTTCCTCGCCTTCTCAAGCGTATGCAGCTACGGCATCCAACCTCTAGAATTCTTGATGATGAGTGTAAGAGCGAGATCGCTG
TCGTTATCGCTCGACTAGCTATGGTGAATTCGGTGGAGGGTAGCACAAGTGAGCTCTTTCTGCACTTCAGAGTGTTGGAATTGCTTACAAACGTGCTGAA
GCAACACCGAGGTATTCTACTCGGTCAATTTACAATAGCATCCGCGTCGAAAAAGACGGATGAAGTGAAAAGATGGAGACTTCTGGTCCATGCTGTTGGT
GCTATCGCTGCACTGAGCCAAGATGTGCTCGTGTGCGTGCCCCGCGTAGTGGCACTTGGTATTGTCGAGCTTCTGTTTCCGTTCCTCATGCGACTTGGAA
ATCCAAACCCACACCTCGTATCTCTTCAGTATGACGCTGTGACGATCATCCGCTCCATCGCGTCATTCCCGTTTGGTGAGTATCATACGTACTTGACAAA
TGTCAACGGTACTGACCTCGATAGTGTTTCGTCGGACGAGAAGAAGAAGCTAAGCAGCAAAGGAGACAAGTCTGTAGCAACAACTTCACCGACAATAGTG
ATGGAGAGAGTGAAGCAGATCGGGTACGACTTCGCGATGGAGCTTCAGAACAAACCTATGGCACTGCGAGACAAGAAATCTGTGGGTGAACTTGCTCGGG
AGACGATGGCTTTCATCAACGAGCATCATCAGCAGCAACAACGGCAACTTGAGCAACAACGCAAGTCAATTGCCATTAGCATTACTGGATCTAAGGATCA
GCATTTGGGTCGGTCGACGGTGGCTGGCAGTCCAATCCATCGAGGCCGTGCGTCTTTTCCAGCTCTTCCACAGTCACCTCTCAGTCGATTAGATGAGATT
TCTGGATCGCGATCATCCCCTGTAGTTTCGAGATCAACAGAGGCAACAGTCCCAGCAACTCCGACGAGTTCTGCTCCTTCAATTCTGGTCCTCGATGGTG
GATCAAAGTCTCCCGTGAGTTTAAACGGAGTGAAGATCGCATCGACTAGGCCACCTGGGAACAACAAGCCGCGCCCCTCTTCCGAGTCCCCGCATAATCA
CCACCACTACGTCTTCACAAGGCCCAAGGCTAAGACTAAACGACGAGATCAGGACCCAGCATACTGTTTAATGCTCGACCCGCTGTTTGATTCTGGTTCT
GCTTCGATGAATTCCAGAAGACTACCCAGCAGCAACGTGAAGATAACGGATGAAGCGCAACAGGACGAAGTACTCAACCCCTGCAGTTTCTCTCAAGAAG
TTGATCACTTTGGGCATTACGTGAACGTGCAGGCACGCCGCAGCAAGAAAGGAGATCGATACTTCCCGTCACTGGGTCGAATTGTCGCCTCAGATACTAC
GTTTTCACCTTTATCACCCAAACCTGGTGTGGACAGCCCGGAATCTAAAACTCTGCAACAAACGAGAGCAGCTTTATCATGAGAACGATGCCGAGGTTGT
TAAAAACAACAAACCTTCTATTAATGCGATGAATGAGTCTAGCATCCGCCAACGACATCGTGGCACGAAGGGAAAGAGATCCTCTCATAAGCTGCAAGGT
GAGCTATCGAGATAGACGCTTGCGAACTCAAGGGAAGTAACCATTGTCACCCGTTTGGCGCGCCGCCGGGATAGTGCCGTTGGACCCGTACGTGTTCCTG
CCTGGGCCATTGCGACCCAGAAGCCGCTGGGAGATGTCGCTACCACTTCCACTGCGGCGAATCACATTGGGACTCTGACGATACACCACCTTTCCGCGGC
GTTTGCGCATGAGATGCGTCTTCTGCAGCGAAGGCGACGCGTACATGGGCGATTTTTCCACAGACTGAGTGCCGCGTTGGCGCTCTTCCTTCTCGGAGTG
GTATACGAGCAAACCCATCACAAGAACGAAAAGTGCGAAGCCGTCGTATATAGTGAAGGCCTGGCCGGCAAACTTGCCCGTGAGCAAGGGGATCATGTAC
AGCAGGTCGGTGAGAGGGAGTCCCACAGCAGACGAAACAACAAACAACACGCTGCTGCCTTCCTTGAAGATATACAACATGAGCTGATTGTACATGGTGT
TGAATATGATGAAGACAAGGAAGACCTGCAGCACGCCCGAGTCGCACGGCAGCACCTTGCCGTTCAGCTCAACTTCATTGCCGATAAAACACTCGTGAGC
CTTCGTCACATACGACGGAAAGTCTCCCCAGGGCACAGGCGGGTCGCTAAACGCCTTGATGCGTATGGTCCAAATCGTGGCGAAGCCGATGATAAGCTGG
TAGAAGCTGATCCAAATGTTGGCATACCAGATATCCAGATCCACATCCTTGAGTCCAATTTCCTTGTAGACGTTCGACGCCGCTGCCGGTACAAGCGACA
CGATATACAAAGTGATCCATCCAGCACTTGGGTCAGGCGTGTTCGCACTGTCCTGTCCTGTGAGGACCGGGATCAAGTTCACCATACCGCCGTACAGCAC
AAGAATCGATCCCAAGATGTGGCCGCGCTTGAAGCGCGTCTGCAGAAACATGTAGGACAGCACCATGTTGAACGGCAAATTAAGCTGGTTCAGCACATTC
GCCATGTTCCCTCTGGCCAACATCAACAAAAGTAAGTTTCTCCAGTTCCACAGAAAAAAAGGTGTACGATCTTCGTACCCGATGTGAGGCGTGGGGAACG
CGCCCAGCAGGTTGTACAGTGTGTCGAACAGCGCCATGAGCATGTACTTGTAGTGCGGGAACTCGCGCATCTCTGGCGTAATGTCATCTATACAACAACA
GCGCATGTCTCCAGTCATTTACCACAAGAACACCTAGGCAAGTGCCAAATCCTGACTCACCGGTGAAGTAGAGCTTGTACCTGTCCACAAGTTACGTTAG
CAGCCCCAACCACCACCAGTTAACTAATATATCATCACTTACGCCACTACTGGAGCCGACGAGACTAGGAACGCGACGGGGAGAATCACGTTCGTAAAGT
ACCAGAGAAACTCCGTGTAGTCGTACGTGATCCGCCTGTACACACACAGGAACGTAAGCGACCAGTATAGTAACCATTGCACTACAGCTCCCCACGCACG
TGTATAACACGCGGTCCACGCAGCGAGCCATGATGAGCAGACACAGCGCCACCGCCAACTTCGACTCCCACAGCAGCCGCTTGACGTCCATCTTGGCCGA
CTCAGGATCCAAACAAAAAAAGAATGGTACCTGTGGAACATAATGCTTTTCCTGCGAAAACACATAGGGTACGAATTAGGAAGGATCTGCCGGCCGCCAT
GGAGGACCCCGGCATGAGCCGCATGCAGGAGCTGCTGAGCAGCTACTACGGGCTGCAAGACCAGGAGAGCAGGCAGGGGCAGCTGCGCAACATCGACTCG
CC