Description :
From Genome Similarity Track
Location :
Scaffold_721:7016- 11472
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_721-snap-gene-0.6Tubulin-specific chaperone D

Sequence
4456 bases(100 bases per row)
TTAGAATCGACACGGATCCCGAGAGATCCGGCGGGTACCGTACTGCTTTTTCTGCGGTGGCTCCATGCCCAGCAGCTCGAGGACCTCGTTCCGTGCAACT
CGGGCGTCAGCAATCTATAACCGAGTCCACATCCAGTTAGCTGCACTCCAAGTACTCACGTTTCACCTGTCCATTTGCGTACCGATCCGTCCCACGCTGT
CCCGCTTAGAATGTCAACGATCGCGTCGTACTATAGGGAATAACATTATCCAGTTAGAACTTTCAAGCCGGAGTTGGCACGATCATGCGTACCTTGGATT
CGTCGATAACTTCTTCGTGGACGAGTAATCGCGTGTACAGTTTCTCAGCCGTGAGCTTACGCACTCTTGGGAAGCGATGTGCGAGAAACAGCACCAGTGC
CTTGAGTACTTTAGTCTCCGTCTCGGTTTCACTGGGAAGGAGCCCAATGAGGACGTTGACGCCCGCAGCTAGTTTGGGAATGGCATTGGTCGTGGCGATC
TCCCCCTTGAGCGCAGCGTATAGTCGGTCTCCAAACTCGGTCACCCTGGCGTCCTCATCAGACGGCTTTTCAAACAAGAACGACAATAATCCATCTTCTA
GAAGCATCGCGAGCGTCTTCATGAGCGGGATCGTGACGCGGTCGTCTTGGGAGTGACGCGACAGCAATGTCACCAAGAAGAACGCGAAGCGACTCAGCAA
TCCGAGATTCTTCGCCGCTGCATGGGTACGAATCCAATCGAAAAGTGCCGCTTTCGAGGCCTTCACGACACTCTCGGTCAGTCCGCCCACGCTCACAACG
AGACCCGCCGCGGATGCTTCCATATACTCTGGTACATCCATTAACCGCACAACCAGCGGGAAAGTGTCGTGGGCCATGGACCAGTTAATCGAAAGCGACT
CCGGGAAGATTTGTTTCTCGAGTTGAAACCGATCCGGGATGCCATCGACGCGAGGGTCTTGGGAATGGAGCAAACGAAAGAGAACCGTGCCAGCGACGAC
ACGAATGCTGTCAAGCTTCTCTGCGAGCTGTTTCACGAGCGCACAGATCTACAAAGAGGATGTCAGGTGTCGATGGCTGTTGTTGATGATGATCCGCGAG
AGGAAAATGTTGGGCAGCTACGTACCACCTCCCCCGTGATCGTTGGTGGTATGCGCCGTGCAAATGCCAGTGGGAGGACAGGAGACCTGCTGGGTGTCCG
AATTCGTTCTGCGGATGCTGGCAGATTAAAAACAGTCGAGTCGACAACCTCTTCTTGGAGGACATGTAGCCGTCGCATCCTGATGAGAGCAGTTCCCTTT
GGGGGAAAGTAGTAGAATCCGAGCGTGGGCTTCTCAAACGCGACATGACACAGGATTTCGGTATCGGTGCCATCGGAGCCATCCACAGCAGACATGTTCA
GATTGTCGGCATCACCAACCACGCGAGAGATGACCCCTGGTCCATAAGGCGTGGCGACGCGTCTCCCAACATATCTGCGCTCCAAGGCACGGATCTTGAA
AGGATAGTCCAGCAATAACCGTTCGAGGCCGAGCATTGCTTCCTTCCGCACCCACGAGCCAACATCGCCGCGCTCGTCCACACCGTAATCATACTGGACG
CAGTTCACGAGGGTCCGCACGACATTCTCTACGAGTGTCTCATCGTCCAGCACGAGAGGGTCCACACCACCGCCCGTGCGAGAGCAGATATCCACGAGCG
CTTGAATAGCTGCGACCCGACTTTCTGCGTCCTGTTCATCGTCGATCTGGGCGCGAATGTCAGCTGCTCGAAGCAACACACGAATAGTATCGCTCAAAGT
AGCTTGAAGCAATGGTGTGGCAGCCACACCCAATGCCCGAGAGTAACCTCGCCGCGTCGCGACGTTGGGGTTCAACACCATGGCTTCATTCTTGCCGCCT
GGTGCCTTCGCGAGCATGCCACCATTCAAGTAGCGCGGCACGATATCAGTGAGGAATTGCCGCACTGCCGGTGTGCCTTTCTCAAACATGCGCGGGCAGT
ACTGCGCCGTAAAGACGGCAAACGCATCGATCGCGGCTGAACGCACACTTTCGACTCCGTGAACCAGACACTCCTCGAGGATCGTGAAGTACTTTTTCAC
GTTGACAAAACTGAGAGTAAACCCAGCCAGCGCGTTCACCTGAATGAGCTGACATACAGCAGCTCGGATGGTCTCTCCACCACGACCGCGGAATAGACGC
TTGGACTCAATTTCGAGCGGCAGCGCCTTGATCTTGGCCTGGAGCTCGCCGTCGATAAATATTGGCGCCACCACCAACGCACGCAGCACGTGTCCGATCG
CGAGGGTCGCACCATGTCGTGCTGTGACTTCGACTTCGGCTGATACTGCCATGCGCAGAAGCTGCGGTAACACGTAGGCCATCGCATGCGTACCATCCAA
CGCCGCAATCTTGCCCATGGCTTGGGCAGCGAGTACTCGAATGTTCACGTCCCAGTGCTGAATCTTTTTTGACAGAAGATGGTCCAGAAGAGCATAGCGA
TACTCGGGGTATTTTGCGATGAAGACACTGACATCCAGATAGGCGTGACGCAAGTTGGCGACACTGAAATAGTCAGCCTTGGTCAGCAGGTCAATACCGT
GGGGGAAATTGAGTCGCCCTTGGCGACCGACATTTTCTTGGAAGGCTGCAGAGGCGGCACGGCGACAGTTGAGCTCGCGGTCGAAGACGCAGTTGATCAG
CATGGCCGGCGCGAGCGTCTTCTCCACGTGAGGCAGCAGTAATAGCGGCTCGTACGCGCGCGCGAACGACCAGCACGCGTAGCAGGCCGCGTCCCGTACG
TGGGCACCAATACTGTGGGCGCCACGGCGAATGTCGTACTGCAATGCACGATATACACAGTCGACGGCCTCCGTCAATCTCTGCGGGAGCAAGACGCCGC
GCCGCGCGAGTTCTGCTAGCGCGAGGCTTGCACCGTGCCACGCACCTTCGCTTTCGGTCGCGACAAATAGCTCTAGCACAGACTGGACAACGTCGTCGGC
GTACTCGAAGGGGAGGCGCCCCGTGATGCGACCAATTCCTTTGGCAGCCGACCACCGCACGACGGTATCCTTGTCACGAAGCCCGCATAGCAAGACGTCG
ACAATCTGCTCGAGTTCTTCGACGGCTTCAAACGGCACATCGTCTTCCTTCTGTTGCTTGGAAAGATGCTGTGTTGATTGAGAAGGCGTATGGGCGAGCA
GGCCAATTCGCTGCATATTCATTTCGAGCGACCGCACGCCGCGCTGGTACCGCCACGACTGCACACGAGGCGGCAAGTACAGGAGCCCTAGTCGCTGGAC
CAACTTGACGCTGAGCTGGCGATGGAGGGTGCTGCTGGTCTGTGGCGAGCGGTCTTCGTCCGACAGCGCACTGATGAGTTGCATGACGCTATTGAAGTAT
ATGCGGCTCGCATTGATGTGCTTGTCTCGAGGCGAGCGCTTGGCGAGGTATGCGAGACACCGCATGATGCCCGTGATCTTGAACTGCTGCACGCGCCAGT
GGCTCTGCGGAATGGTTGCGTCGGGCTGTGTCGCCGGCGTGACTGCCGAGACGGCTGACCGTAGTTCACCGTCCGCCCACTGGAGAAACCTTTCGAGATG
GTGTGCTTCCATATCCGGACGGCTGAGCAGCCGCGCGAGACAGACCGCGGCCGCAAGTTGCGTCGCGCCAGCGTCAGCCAAGTAGCCTTTGCAGAGCGTG
AGGATGTTGCCCACGAGCGAGTGCGTAGCCGACGAGTCGATCGTGTTGAGATCGAACGGCACGAGGCAGAGCATCGAGAGCCAGAGCAGCAGCACATACC
GCGTCTCCCACACGCCGTGGTCGGCCCGATCTTGCGACTGCAGCAACAGAAGCGTCGGCTCCAAGTCGCTCACTTCATGGGGCAGCAGCTTGACGATCGT
CTTGTAGCCGCGCACTTTTGCCAAGTGGTACACGAGCTGGAAGAGCGCGTGGAGCTTGGGGTTCTTGTAGATTTGGAATGGGAACGCGACGCCCTGGTCG
GAGGCGACGGCAGCCGCAGCGTCTTCGCGCTCGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGATGATGCGCTGGATCTCGGTGAG
GATTGGCGCCAAGAGTTCGCGCAAGTACGGGTCCAACAAGTGCGCCTGTTCCATGTAGCGATCCAACTAATCGCCCCAGAGAGAGAGAGAGAGAGAGGAG
AGAGAGAGAGAGAGAGTGATCATTCCTTCTCTTCGTACCCGAGAGAGAGAGAGAGAGAGAGAGCCCGTCAATACGAATCAATCGCAGAACTAACCACGCC
CAACGTACGATGGTCGTGACAGTCTTGTGGTTGCGCGCAAACGTGTCGTCAACGTCGCTTTCAGGAAACGGAAACGCCGCGCTCGCGAGCTGCTGTAGCA
AGGCGGCCACTTGCGCGCGCTCTGTGAAGAACTTGCGCTGGCTGCAGGCCTCGTCT