Description :
From Genome Similarity Track
Location :
Scaffold_374:7015- 9614
Sequence
2599 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCCCCAAAGGGGTCTACGGCATCCGGCCTTCAGAGAGGCGGGAGGATTTGG
CGGGTTCGAGGCCCCGTCGGGAGACTTTCACTTTTGCACAGCCTCAGGATCTTCTTGGCTATGATTCATCCGATTTGCCCTTCTACGGGCTGTAGCGGAT
TTCATGCCGCTTCTGACTACTCGCTTTAACTATTGCAGTGCGCCCCCCAAACTGAAAAGGGACCCGCCCGGATGATGTCGCTATGCTCATCAACGCACCC
TGTACTTCACGTAAACTTTTAGCTCTGCAATCCGTCGGCAACATGGTCTCCACGCTTACTTCGTCTGTTGATTTTGGTCTGCCGCCCCATCAATACCTGT
GGTTCTTGTAGCGATATGGGTCGCCCGCTCGCAGGATGTGATGCGAGGACGTCCACCACTACCGCTTACAGCGAATCACATATCTAAACTGCCCGCCAGC
GTGAGCACAGCCTTGGCTGTTGACGAGCCGTCCACGACTACCTGCCCCGACGTAGACAGCTTCGTCAGTCGTCCACTGTGAGCAGGTAGAAAGTCGAGCT
TTGCTGGCCTGCCGCCAAGCAGCGGTGGACAGCCCAGATGAGTGTGAGTATGCTTCCGAGTCCGTGAGGGCTCCCGTGTGTGTGGTAGCGCGTGTATGAG
TAGCGTAATCGATGTCTTTTGTGTGTGGCTGTGTTTTTCCCAACGTTGTCGCTGTGGGAGGAGGTTGAGTGGTCAGAAGCGTCCCCGTGGCCCAATGGAT
AAGGCATCCGCCTACGAAGCGGGAGATTGCGGGTTCGAGTCCCGTCGGAGACTTCTCTTTTGCACACTTCAGATTCTCTTGCCATGATTCATCCGTTTTG
CCTTCTACGGGCTGTAGCGATTCATGCCGCTCTGACACTCGCTTTAACTATTGCAGTGCGCCCCCAAACTGAAAGGGACCCGTCCGGATGATGTCGCTAT
GCTCATCAACGCACCCTGTACTTCACGTAAACTTTTAGCTCTGCAATCCGTCGGCAACATGGTCTCCACGCTTACTTCGTCTGTTGATTTTGGTCTGCCG
CCCATCAATACCTGTGGTTCTTGTAGCGATATGGGTCGCCCGCTCGCAGGCTGTGCTGCGGGGACGTCCACCACTACCGCTTACAGCGAATCACATATCT
AAACTGCCCGCCAGCGTGAGCACAGCCTTGGCTGTTGACGAGCCGTCCACGACTACCTGCCCCGACGTAGACAGCTTCGTCAGTCGTCCACTGTGAGCAG
GTAGAAAGTCGAGCTTTGCTGGCCTGCCGCCAAGCAGCGGTGGACAGCCCAGATGAGTGTGAGTATGCTTCCGAGTCCGTGAGGGCTCCCGTGTGTGTG