Description :
From Genome Similarity Track
Location :
Scaffold_113:70141- 76654
Sequence
6513 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAATCTCTTGGCGCTACCAGTCAATACCCTACAAGCTATGATACTCGAGTATTGACG
GCAGGCATAATCCAGCCCTATGCGGGGACTTACCGGAAAAGTGTACACGTGTCTTGGACTAGGAAAATTTTACTCTGTTATCTTCTGGAAGCCCTTTCGG
CTCCCCCTTTTTAATCCTATGCTTCTCATACAAATATCTGGTGAAATGTAGTCGTTTCGGATCTCTACCGACCCTTCAGCTGAGTTCCGGCGACCGTTGA
GCTCAGCGGCTATCCGGATAGCATATCCGGACAGATCGCCGAGTACTTACCGTGATCATTTGCTCCTAAGCTCTGGGTTATCGATTCTTGACCTAAAGTA
GGTTGGCGTATGGTCGAATCTGGGAATCCCTACACCACAACTGCCCCGGTTATGATAGGAGCCGAGCTGGTGAGTGTCTTAATCCTTCATTTGGTTCCGC
CACCGTTGGTCCATACTCGGCTGATGACGTCCCGCGGCTCTCCACCACCTTCTTCGGTACGTTTGTTGCTTCCGCTGTCACTCCCTTGGCAGCTCCTTAC
TCCTCGCTTGTTACTCCAGCACAACTCGCGGCACCATAATCCTTCTCCAACTCCTCGTCGAGGTGAAGGCGTGCCAGCTGAGTCGATTCTCCGACCCGTC
GGTACTCGTGGGGTCAGCGACCGGCCTGAGGCTCGGCTGGTTGACCTGACAACTTCCCATGAGTCTGACGCGGAGTCGGCGGGGTCTTCTCGCGTGCGCC
TTCCTGGTCCACCGAGCTTGTCGGGCGACACCACTTCGGGCGCCACCAATCAGCCAAGCTCGGCTGCTCCAGTGAGTCTTGACTCCCTCATGGCCAGAGT
CAACGAGCAAGGGTATGAGCGCCGAGAAGAATTGACCTTCTTGGCGAGGCTCATGGCCTACGGATTTACTCGTTCCGTGGGGCCCTCCGATCCCGTGCAG
CGGCGAGCGATTTTGCATGCTGCTTCCGCGGGGGAACTGTTGGATATCTTGAAAGACAACTACGGCGCTCTTGATTATCCAAAGATCATTGGCGATCTCC
GAGCTGACAATCAAGCTGTTCAGGAGAAGAACCGCGCACTGACTCGGCGACTGGACTCGCTTGCTCTCAGCAACGTCGACTTGTCATTTCAGCTCTCGTC
GGCTCAATAGCAAGTGTTTCGATTGGAGGCTGCTGCCACGCAGTCGGCTAATCTCCTTGCGTCACTGCGAAAGGCTGTAGCTCTGAGTGAGGAAAAACTT
GCTCGGGCCATCGCAGCTGAGCAGATCAAGGTTGACGCTGCGTTGGGTCAGGCCCAGCTCCATCATCAGCAAGCCTTGGATCGAGACGCCGAGATCGACG
TCCTTCTCCGATCCATTTCTGAGAGGGATGCGGCGTTCGTCACCCTTCAGGGCATTGCTTCCAAGCACTTCGAACAGCTGCAGGAGTCGGTGCGGTTGTA
CAGCTCCACAGGCACTCAACCTTTGCTGCACGCTCAGTCGGTGATCGCCGAGCAGCGGGCGGTGATCTTGCGACAGAAGCGGCTCATCCGTCGGAATGGC
ATTATTCCGATGCACGACCCTCACATGGCTGCTGCTGCTGGCGGTGGATTGCAGGTTCCTGGACTTGATCCGTCCGACCTTTTCCTTAACGCTCGGCTGT
GTCGTGTCTTGGAGTCTCGCTTCCCTGAGGTTCTCAACATCCCAGCTGGTGAAACTCGGCGGTTAGAGTTGATTGTCCATCCTCGCCGAGACGCTCCAGT
AGCGAGTTCCGTTATCGGTCCTAGTGTGGCTCCCTCAGCTAGTCAAGCGTCTTCGGTGACTTCATTGGCAGACTCGGCGGAGGCTCCAGTCAGCTCAGCG
GCGGCTACGAGCCAGGCTGAGCCGACTCTTGCCCAGCTTCACCGTACGCCTTTGGCGAACTTGACTTCGACTCAGCGGCTTCGGCGTTATGCCAACCCCA
AGTCTCCCACAGCTGCAGGTCCTCGTCATCGTCCACCGGCGCCGCATCCGCCTCAACCGTACGCTTGTCCACTTCCCGGGGAGGATAGACACGAGGCTAT
CAGTGCCCTTTTGCACTCAAGTTCACCTCAAGCTACTGTATCCGATGGAGGAAGGCCTCGCTCTGGAAAGTCCCGTCGTCGGACTCGGCGGAGAAGGTTC
GTCCCCTTCAGCTGAGTTCTGCTACTCAGCCCGCTGTCTCTGCTCGCTCTGAAGACGACGATGACGCTCGAGCCGATGCTGAATTCGAGTTTGAGTTGCC
TGAGCCGCCCGCCGACACCGTTCCTGCGGTTGCTTCGACGACTCCGGCGGGTTCTTTGTCTTCTGGTCCTCCGGTGACTTCGTCAGTCGCGGCTACTCGC
CCACCGCCGATATCTTCGTCCGATGTCGTGGCTTGGCTGCCTGTCCCGGCTACGAGCGTTTGTGCCCCAGGCTCGACTTCGCTCATCTCCGCTGGGTTGT
CCCAGTCGAGTGCACCACTCAGCGTCGTACCAACGGTGGTTAGGCGCTCCCAGTTGTCTTCTCGGGGTCTGAGCGTATCCACCACGCCGACTGACCTAGT
GACTCCGGCCGTGAGTGTCCTCAGACCGTCTCTCCCTGTGACCACGGCCGTGTTGACGTCCCCATCTGGGGGCCCTATCCGGAGATCTGCTGCGACCGCC
CGCACTGTGACTGCTCAGCTGCTTGAGGACCTCGACGCGTCTGACGACGTGGTGTTAGGGCCTGGTGATGGTTCCGCACCGTCCACCGGCTCGACGAATC
CTGCCGCTGGGTCGCCCTTGGATCCCATTTCCTTATCAGAGAACTCGGCTGGCAGTCCTTCAGGTTCCGACTCAGCGACCGCAGATGCTCGTCGTTCTGC
CAAAGCATGAAGCCTTCATGCGGCAATCTTCGGCTCTGACGACGAGATGAGTGATGAGTCCTTGCCGCCGAGTGATCGCCACTCCTCGCGGCCTTCATCG
AAGGATTCTGGTGACGGGACGAGTTCTGCCCCTGCGCCGGCTTCGGGAAAGCAGCAGCATCGCAAACGTCGTGCCTCGTCGAGTCCTACCGGTCATCGGT
CGAAGCGATCCAAGAAGCACAAGAAACACAAGAAGCATCACAAGACGCACCGACACCACAAGCATCGGCAGCTTCCGTCGACTCCTGATCCAGCTCCGGC
TCAATCCATTCCGGCTGCTCCTTCGCCGAGTAGGCTCCCGGTTGTGTCGATTCTCTCTCAGCCGAGTTCGACTGCCTCACGTCCGGCTTTGGTCGCACTA
CCCAGCGCTCTTACACTCCCGCTGGCGACGTTACGGACTCGAGCCTCGCAAGCGGTGTGCAAGAATGTCGCTTGACTCTTCACATGGCTCAACTCCGCGA
GGTACCATTTATGCATTTCGGCTCAGCCCGTTGTTGGAATGCATTATTAGATACACTGAGCGGAGGGGTGCAGATGGAGCTCGTAGGAGGCAAGAGTCGT
GTGCCACCTACGCCGTGTTCTCTTGACGGCATTCGAGCTTTCATGGCCGTTTTCGATCCGAGCCATCCTTGTCAGCGTCTTCGGCGGATGCTCCCTGAGC
TTCCTTTCTTCTTTTCTCCGTCGATACTGGAGGAAGCTCGGCGGTGTTTGGCTTCTCAGACCCGACCTCGAACTTTGATGCAAGTTCTTGGAGATATGTG
GGTGAAGCTTCGTGGCGACAGTCCCTTGGACTCGGCGGGGAGGACCATCCAGACAGATGGCCAAATGACCCGTTACTTCGTAGCTCTCTATGAGCGTCGT
CATTGGATCGTCGAGTCGAGTGTGTTGATGGGTCTCCATCCCTGACGTCAACCCGGCTGCCACGCCCGCTCAGCTTTGCTGAGGTGTATGAGCTGTGGCT
GGTGTACAAGCGTGAACGCAAACGTCGTAGTGACACTCTGCGATCTTTGGTTGTCGCTGTCTACGATCAGCTTTACTCGGCGGTCACTCAGAAACTCGGC
GATGAACCTGCTCCTCCGGTGGACGCAGAGGTTTATTTCGACCCGTCCGTCCCCCATTATTCTCCCGTTAACCTTTCGTGGGTTCCCTCCGGGAGAGACT
GGGTCCAATGTGCTCATGATGTGGATCTAGCTGAGCCCTGGCGAGCTTGGTGGCTAACTGACCCGGCGGTCCACCCGTATAACACCTGCTTCCGCGCTCG
GAACGTGAACTTCTTGGTTTTCGCTCCGCGCGGTATGGATCCTCAGGTTGTTGACGACGCGATTGAAGAAGACTTTGATCTTGCCGAACAAGCGCCTCCT
GCCTATGCCCCGGGTACTCCTACTCGGCTGAATCGTCAAGGCATCCACATCTTCACTGGGTCGTCAATCGGTGAGCTCGGCTCAGATGACGAGAGTGCGT
CTGATGACGACTCGGCGGACGATGGGTTGGATTCTCCCAATCTCCGAGGCGCGTCTCCGAGTATGTCTCTGTTCGGCACCCCACTCCTCAGTGGAACGGA
TCCGCCTCAACCCACTTCAGCTGAGTCGGGTCCTGAGGCACCTGGTTCGGCGTCAGCTTCGTTGGCTAGCTCGGCGATGATACTTCTTGCAACGGCTGCG
AATGTTGCATCTCCTTCCGCAGTTTCCCAAGGGATGACGTCTGCTACGACGCCACGCCCCCAGTCGTCGAGTCCGCTGAGCTCTTCCCAGTTGTCTCCGT
CGAATTCAACTCACTTGGAGTCCGGATCGCCGACTTTTTCGTTGTCTTCTTTTGACTGGGCGTCCCGTAGGTATCGTTCAAGACTTCATTTCGTAATTAT
TCTGTATATGTAG